Mutagenetix > Incidental Mutation

Incidental Mutation 'R5263:Aqr'

401540

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

042831-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113931642-114005788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113947059 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1041 (M1041T)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: M1041T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: M1041T

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: M1041T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: M1041T

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140441

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh4	G	T	3: 138,133,816 (GRCm39)	V309L	probably benign	Het
Agmo	T	C	12: 37,407,680 (GRCm39)	V188A	probably benign	Het
Arhgef4	T	A	1: 34,764,078 (GRCm39)	S1111R	possibly damaging	Het
Ascc3	A	C	10: 50,592,757 (GRCm39)	E1144D	probably benign	Het
Cct3	T	C	3: 88,228,672 (GRCm39)		probably null	Het
Cd209f	T	C	8: 4,154,506 (GRCm39)	T114A	probably benign	Het
Cgnl1	G	A	9: 71,539,936 (GRCm39)	Q1103*	probably null	Het
Cop1	G	A	1: 159,152,507 (GRCm39)	D586N	probably damaging	Het
Dcaf5	A	G	12: 80,395,120 (GRCm39)	S350P	probably damaging	Het
Dhx29	T	C	13: 113,084,755 (GRCm39)	C658R	probably damaging	Het
Dync1i1	G	A	6: 5,969,446 (GRCm39)	V424I	possibly damaging	Het
Gfap	C	T	11: 102,787,756 (GRCm39)	R63Q	probably damaging	Het
Gm10563	CTTT	CTTTATTT	4: 155,698,940 (GRCm39)		probably null	Het
Gprc6a	C	A	10: 51,502,900 (GRCm39)	G321V	probably damaging	Het
Itgb4	C	T	11: 115,874,983 (GRCm39)	R447W	probably benign	Het
Izumo1r	A	G	9: 14,812,976 (GRCm39)	C99R	probably damaging	Het
Lrp1b	T	C	2: 41,850,691 (GRCm39)	D102G	probably damaging	Het
Mettl4	G	A	17: 95,047,937 (GRCm39)	Q235*	probably null	Het
Mmrn2	A	G	14: 34,121,541 (GRCm39)	T804A	probably benign	Het
Mrgprb5	A	G	7: 47,817,937 (GRCm39)	V266A	probably damaging	Het
Ntng1	T	C	3: 109,842,188 (GRCm39)	D195G	probably damaging	Het
Pld4	T	C	12: 112,731,465 (GRCm39)	L206P	probably damaging	Het
Polr3a	T	C	14: 24,505,009 (GRCm39)	I1084V	possibly damaging	Het
Prkd1	A	G	12: 50,435,089 (GRCm39)	L546P	probably damaging	Het
Rhob	A	T	12: 8,549,232 (GRCm39)	M134K	probably benign	Het
Ryr3	A	G	2: 112,548,347 (GRCm39)	S3087P	possibly damaging	Het
Sema6c	T	C	3: 95,080,463 (GRCm39)	L887P	probably benign	Het
Sltm	T	C	9: 70,492,081 (GRCm39)	S648P	unknown	Het
Sucnr1	A	G	3: 59,994,190 (GRCm39)	I239M	possibly damaging	Het
Tgtp2	T	A	11: 48,950,090 (GRCm39)	M161L	probably damaging	Het
Trpm7	A	G	2: 126,663,137 (GRCm39)	V1037A	probably benign	Het
Vmn2r13	A	T	5: 109,321,841 (GRCm39)	H285Q	probably benign	Het
Zfp971	T	A	2: 177,675,555 (GRCm39)	C385S	probably damaging	Het
Zfpm2	T	A	15: 40,962,791 (GRCm39)	V283E	probably benign	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,584,556 (GRCm39)		probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	113,956,423 (GRCm39)	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	113,982,006 (GRCm39)	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	113,950,508 (GRCm39)	nonsense	probably null
IGL02297:Aqr	APN	2	113,980,962 (GRCm39)	missense	probably benign	0.24
IGL02380:Aqr	APN	2	113,940,417 (GRCm39)	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	113,967,398 (GRCm39)	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	113,949,261 (GRCm39)	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	113,943,127 (GRCm39)	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	113,943,835 (GRCm39)	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	113,965,305 (GRCm39)	splice site	probably benign
IGL03001:Aqr	APN	2	113,977,400 (GRCm39)	missense	probably benign
IGL03092:Aqr	APN	2	113,989,424 (GRCm39)	missense	probably benign	0.38
IGL03222:Aqr	APN	2	113,951,737 (GRCm39)	missense	probably damaging	1.00
capricorn	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
Goat	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
Pliades	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
sagittarius	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
Zodiac	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	113,961,215 (GRCm39)	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	113,989,491 (GRCm39)	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114,000,533 (GRCm39)	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	113,988,085 (GRCm39)	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	113,961,092 (GRCm39)	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	113,961,085 (GRCm39)	missense	probably benign	0.00
R0685:Aqr	UTSW	2	113,971,458 (GRCm39)	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	113,947,136 (GRCm39)	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	113,980,890 (GRCm39)	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	113,992,133 (GRCm39)	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	113,967,485 (GRCm39)	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	113,961,015 (GRCm39)	critical splice donor site	probably null
R2377:Aqr	UTSW	2	113,971,421 (GRCm39)	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	113,967,398 (GRCm39)	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R3715:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R4586:Aqr	UTSW	2	113,943,058 (GRCm39)	missense	probably benign	0.06
R4663:Aqr	UTSW	2	113,992,147 (GRCm39)	nonsense	probably null
R4809:Aqr	UTSW	2	114,005,695 (GRCm39)	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	113,940,418 (GRCm39)	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	113,943,832 (GRCm39)	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114,000,506 (GRCm39)	critical splice donor site	probably null
R5050:Aqr	UTSW	2	113,943,090 (GRCm39)	nonsense	probably null
R5213:Aqr	UTSW	2	113,943,808 (GRCm39)	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	113,979,515 (GRCm39)	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	113,986,746 (GRCm39)	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	113,957,442 (GRCm39)	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	113,973,530 (GRCm39)	nonsense	probably null
R6015:Aqr	UTSW	2	114,005,646 (GRCm39)	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	113,986,758 (GRCm39)	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	113,940,445 (GRCm39)	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	113,979,477 (GRCm39)	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	113,947,052 (GRCm39)	nonsense	probably null
R7211:Aqr	UTSW	2	113,965,204 (GRCm39)	missense	probably benign	0.01
R7232:Aqr	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	113,934,543 (GRCm39)	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	113,950,427 (GRCm39)	nonsense	probably null
R7490:Aqr	UTSW	2	113,989,349 (GRCm39)	critical splice donor site	probably null
R7526:Aqr	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	113,945,074 (GRCm39)	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	113,992,161 (GRCm39)	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	113,943,806 (GRCm39)	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	113,949,358 (GRCm39)	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	113,967,474 (GRCm39)	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	113,934,528 (GRCm39)	missense	probably benign	0.04
R9527:Aqr	UTSW	2	113,932,037 (GRCm39)	missense	probably benign	0.02
R9664:Aqr	UTSW	2	113,971,396 (GRCm39)	nonsense	probably null
Z1176:Aqr	UTSW	2	113,940,472 (GRCm39)	missense	probably benign	0.25
Z1176:Aqr	UTSW	2	113,938,603 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AACCTTAAGAATGACGGTCTGG -3'
(R):5'- TCAAGAATTGTCTGACTGGGC -3'

Sequencing Primer
(F):5'- GGTCTGGTAAGACAATCAAG -3'
(R):5'- CAGATTGTGCCTGGATACACATAAAC -3'

Posted On

2016-07-06