Incidental Mutation 'R5264:Col4a4'
ID401578
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission 042832-MU
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82493591 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 681 (G681E)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: G681E
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: G681E

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
aoba UTSW 1 82535740 critical splice donor site probably benign
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCCTCTGTCTGTTTTCTTAAGAG -3'
(R):5'- CCACACTGGAAAACTTTTGGGG -3'

Sequencing Primer
(F):5'- CTCTGTCTGTTTTCTTAAGAGTATCC -3'
(R):5'- CCATGAAGGGATGCTGCTTAC -3'
Posted On2016-07-06