Incidental Mutation 'R5264:Phactr4'
ID401591
Institutional Source Beutler Lab
Gene Symbol Phactr4
Ensembl Gene ENSMUSG00000066043
Gene Namephosphatase and actin regulator 4
Synonyms3110001B12Rik, C330013F19Rik
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132355923-132422489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132370982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 325 (D325G)
Ref Sequence ENSEMBL: ENSMUSP00000081270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084170] [ENSMUST00000084249] [ENSMUST00000102568] [ENSMUST00000152271]
Predicted Effect probably benign
Transcript: ENSMUST00000084170
AA Change: D288G

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081185
Gene: ENSMUSG00000066043
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 488 497 N/A INTRINSIC
Blast:RPEL 511 535 8e-7 BLAST
RPEL 548 573 2.53e-8 SMART
RPEL 586 611 2.17e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084249
AA Change: D325G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081270
Gene: ENSMUSG00000066043
AA Change: D325G

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
RPEL 73 98 1.35e-3 SMART
low complexity region 125 140 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
low complexity region 194 219 N/A INTRINSIC
low complexity region 231 270 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 335 359 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 525 534 N/A INTRINSIC
Blast:RPEL 548 572 9e-7 BLAST
RPEL 585 610 2.53e-8 SMART
RPEL 623 648 2.17e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102568
AA Change: D315G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099628
Gene: ENSMUSG00000066043
AA Change: D315G

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
RPEL 63 88 1.35e-3 SMART
low complexity region 115 130 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
low complexity region 184 209 N/A INTRINSIC
low complexity region 221 260 N/A INTRINSIC
low complexity region 281 291 N/A INTRINSIC
low complexity region 325 349 N/A INTRINSIC
low complexity region 498 508 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
Blast:RPEL 538 562 9e-7 BLAST
RPEL 575 600 2.53e-8 SMART
RPEL 613 638 2.17e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127516
Predicted Effect possibly damaging
Transcript: ENSMUST00000152271
AA Change: D288G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119767
Gene: ENSMUSG00000066043
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality, exencephaly, neural tube defects, coloboma, and altered cell cycles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Phactr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Phactr4 APN 4 132370992 missense possibly damaging 0.94
IGL01106:Phactr4 APN 4 132370805 missense probably benign 0.09
IGL01962:Phactr4 APN 4 132363775 missense probably damaging 0.99
IGL02382:Phactr4 APN 4 132370841 missense probably damaging 1.00
IGL02466:Phactr4 APN 4 132377172 splice site probably benign
IGL02891:Phactr4 APN 4 132387023 missense probably damaging 1.00
P0027:Phactr4 UTSW 4 132371090 missense probably damaging 1.00
R0317:Phactr4 UTSW 4 132386930 missense probably damaging 1.00
R0961:Phactr4 UTSW 4 132378420 missense probably benign
R1435:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1441:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1443:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1960:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1961:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R2145:Phactr4 UTSW 4 132370784 missense probably damaging 0.98
R3077:Phactr4 UTSW 4 132397996 start codon destroyed probably null 0.53
R3423:Phactr4 UTSW 4 132369747 missense probably benign 0.38
R3782:Phactr4 UTSW 4 132367867 unclassified probably null
R3871:Phactr4 UTSW 4 132377249 missense probably benign 0.00
R4427:Phactr4 UTSW 4 132387041 missense possibly damaging 0.90
R4672:Phactr4 UTSW 4 132370706 missense probably damaging 1.00
R4871:Phactr4 UTSW 4 132378448 missense probably damaging 1.00
R5558:Phactr4 UTSW 4 132378455 missense probably damaging 1.00
R5955:Phactr4 UTSW 4 132386909 missense probably damaging 1.00
R6953:Phactr4 UTSW 4 132377351 missense possibly damaging 0.66
R7210:Phactr4 UTSW 4 132358271 makesense probably null
R7286:Phactr4 UTSW 4 132377178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCTGGGAAATGTCCTG -3'
(R):5'- TGAAAGGTTAGTTCTGATCTGTCTC -3'

Sequencing Primer
(F):5'- CTGGGAAATGTCCTGGAATAGATCTG -3'
(R):5'- TCTCTGGTAAGCCATGGTAAC -3'
Posted On2016-07-06