Incidental Mutation 'R5264:Olfr33'
ID401600
Institutional Source Beutler Lab
Gene Symbol Olfr33
Ensembl Gene ENSMUSG00000066273
Gene Nameolfactory receptor 33
SynonymsMTPCR33, GA_x6K02T2PBJ9-5431102-5430146, MOR11-2
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102712151-102719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102714351 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000149588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably benign
Transcript: ENSMUST00000084817
AA Change: T21A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273
AA Change: T21A

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094124
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210002
Predicted Effect probably benign
Transcript: ENSMUST00000216312
AA Change: T21A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Olfr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Olfr33 APN 7 102713601 missense probably damaging 1.00
IGL02349:Olfr33 APN 7 102714126 missense probably damaging 0.99
IGL02739:Olfr33 APN 7 102714314 missense possibly damaging 0.58
IGL03110:Olfr33 APN 7 102713883 missense probably damaging 1.00
IGL03014:Olfr33 UTSW 7 102713546 missense probably null 0.91
R0158:Olfr33 UTSW 7 102713955 missense probably benign 0.03
R1455:Olfr33 UTSW 7 102713998 nonsense probably null
R1996:Olfr33 UTSW 7 102713792 missense probably damaging 1.00
R2032:Olfr33 UTSW 7 102713876 missense probably benign 0.00
R2152:Olfr33 UTSW 7 102713581 missense probably benign 0.01
R4852:Olfr33 UTSW 7 102713543 missense probably damaging 0.99
R4965:Olfr33 UTSW 7 102713495 missense probably damaging 1.00
R5464:Olfr33 UTSW 7 102713682 missense probably benign
R6680:Olfr33 UTSW 7 102714315 missense possibly damaging 0.70
R7195:Olfr33 UTSW 7 102713666 missense possibly damaging 0.74
R7373:Olfr33 UTSW 7 102714099 missense possibly damaging 0.53
R7391:Olfr33 UTSW 7 102713982 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATCACTTAGGGCTAGCATGG -3'
(R):5'- TGAGCAGAACCAACTTGTTACC -3'

Sequencing Primer
(F):5'- CTAGCATGGACAGAAAGTAGTACATG -3'
(R):5'- CACATCTCCTGGGAATGA -3'
Posted On2016-07-06