Incidental Mutation 'R5264:Zranb1'
ID401601
Institutional Source Beutler Lab
Gene Symbol Zranb1
Ensembl Gene ENSMUSG00000030967
Gene Namezinc finger, RAN-binding domain containing 1
Synonyms9330160G10Rik, D7Wsu87e
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R5264 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location132931142-132986391 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CTGATGATGATG to CTGATGATGATGATG at 132982827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033265] [ENSMUST00000033269] [ENSMUST00000106157] [ENSMUST00000124096] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000169570] [ENSMUST00000210507] [ENSMUST00000215716]
Predicted Effect probably benign
Transcript: ENSMUST00000033265
SMART Domains Protein: ENSMUSP00000033265
Gene: ENSMUSG00000030967

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 9.8e-35 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106157
SMART Domains Protein: ENSMUSP00000101763
Gene: ENSMUSG00000030967

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 1.5e-40 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153335
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169570
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210507
Predicted Effect probably benign
Transcript: ENSMUST00000215716
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased CD4+ T cells and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Other mutations in Zranb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zranb1 APN 7 132982504 splice site probably benign
IGL00843:Zranb1 APN 7 132949893 missense probably benign 0.26
IGL01727:Zranb1 APN 7 132966620 missense probably damaging 1.00
IGL02087:Zranb1 APN 7 132973417 splice site probably benign
IGL02676:Zranb1 APN 7 132966681 missense probably benign 0.16
IGL03081:Zranb1 APN 7 132950397 missense probably damaging 0.99
IGL03095:Zranb1 APN 7 132949906 nonsense probably null
IGL03186:Zranb1 APN 7 132950203 missense possibly damaging 0.68
PIT4151001:Zranb1 UTSW 7 132949994 missense probably benign
R0207:Zranb1 UTSW 7 132950385 missense probably damaging 1.00
R0470:Zranb1 UTSW 7 132982771 missense probably damaging 1.00
R0854:Zranb1 UTSW 7 132949848 missense possibly damaging 0.78
R1318:Zranb1 UTSW 7 132966552 nonsense probably null
R1389:Zranb1 UTSW 7 132971333 missense probably damaging 1.00
R1480:Zranb1 UTSW 7 132950016 missense probably benign 0.39
R1656:Zranb1 UTSW 7 132949767 missense probably benign 0.31
R1956:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R1958:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R2010:Zranb1 UTSW 7 132966696 critical splice donor site probably null
R2289:Zranb1 UTSW 7 132950039 missense probably damaging 1.00
R3831:Zranb1 UTSW 7 132982776 missense probably damaging 0.98
R4128:Zranb1 UTSW 7 132966552 nonsense probably null
R4745:Zranb1 UTSW 7 132972714 missense probably damaging 0.97
R5121:Zranb1 UTSW 7 132950187 missense probably benign 0.06
R5262:Zranb1 UTSW 7 132982827 small insertion probably benign
R5263:Zranb1 UTSW 7 132982827 small insertion probably benign
R5522:Zranb1 UTSW 7 132983949 makesense probably null
R6252:Zranb1 UTSW 7 132983904 missense probably benign 0.00
R6519:Zranb1 UTSW 7 132950128 nonsense probably null
R6671:Zranb1 UTSW 7 132971313 missense probably damaging 1.00
R6827:Zranb1 UTSW 7 132949745 missense probably benign 0.17
R6928:Zranb1 UTSW 7 132966594 missense possibly damaging 0.65
R7313:Zranb1 UTSW 7 132982752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTTCAGGAGGTGGAAAC -3'
(R):5'- CACTACAGGTGCCATCACTTCTG -3'

Sequencing Primer
(F):5'- GCCAGGCACTTGCTCCTTG -3'
(R):5'- ATCACTTCTGGGAGGCACATG -3'
Posted On2016-07-06