Incidental Mutation 'R5264:Rsph4a'
ID401608
Institutional Source Beutler Lab
Gene Symbol Rsph4a
Ensembl Gene ENSMUSG00000039552
Gene Nameradial spoke head 4 homolog A (Chlamydomonas)
SynonymsRshl3
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33905111-33916021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33909383 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 430 (Y430C)
Ref Sequence ENSEMBL: ENSMUSP00000131647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169670]
Predicted Effect probably damaging
Transcript: ENSMUST00000118315
AA Change: Y226C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113543
Gene: ENSMUSG00000039552
AA Change: Y226C

DomainStartEndE-ValueType
Pfam:Radial_spoke 2 494 2.4e-193 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169670
AA Change: Y430C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: Y430C

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
Pfam:Radial_spoke 209 695 2.7e-205 PFAM
low complexity region 702 716 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Rsph4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Rsph4a APN 10 33914343 missense probably damaging 1.00
IGL00536:Rsph4a APN 10 33911656 splice site probably benign
IGL00702:Rsph4a APN 10 33913072 missense probably damaging 0.99
IGL02313:Rsph4a APN 10 33905525 missense possibly damaging 0.56
IGL02556:Rsph4a APN 10 33905152 utr 5 prime probably benign
PIT4519001:Rsph4a UTSW 10 33909130 missense probably benign 0.09
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0088:Rsph4a UTSW 10 33909353 missense probably benign 0.15
R0513:Rsph4a UTSW 10 33912991 nonsense probably null
R1559:Rsph4a UTSW 10 33909731 missense probably damaging 0.99
R1589:Rsph4a UTSW 10 33905529 missense probably benign 0.01
R1783:Rsph4a UTSW 10 33911636 missense probably damaging 1.00
R1914:Rsph4a UTSW 10 33913072 missense probably damaging 0.99
R2046:Rsph4a UTSW 10 33914543 unclassified probably benign
R2280:Rsph4a UTSW 10 33911599 missense probably benign 0.00
R2496:Rsph4a UTSW 10 33908098 missense possibly damaging 0.87
R3084:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R3086:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R4519:Rsph4a UTSW 10 33911627 nonsense probably null
R4965:Rsph4a UTSW 10 33909240 missense probably damaging 1.00
R5077:Rsph4a UTSW 10 33908279 missense probably damaging 1.00
R5359:Rsph4a UTSW 10 33908236 missense probably benign 0.08
R5464:Rsph4a UTSW 10 33909341 missense possibly damaging 0.64
R5615:Rsph4a UTSW 10 33909328 missense probably benign 0.32
R5751:Rsph4a UTSW 10 33905793 missense probably damaging 0.99
R5763:Rsph4a UTSW 10 33905688 missense probably damaging 0.98
R5832:Rsph4a UTSW 10 33909502 missense probably benign 0.01
R6243:Rsph4a UTSW 10 33909143 missense probably damaging 1.00
R6654:Rsph4a UTSW 10 33912992 missense probably benign
R6918:Rsph4a UTSW 10 33905276 missense probably benign 0.00
R7081:Rsph4a UTSW 10 33909193 missense probably damaging 0.97
X0057:Rsph4a UTSW 10 33905727 missense possibly damaging 0.58
X0066:Rsph4a UTSW 10 33913009 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGATCTTGGGTCTGGAAATGAAC -3'
(R):5'- CTGAAATGCGGGCAATTTGTG -3'

Sequencing Primer
(F):5'- GGTCTGGAAATGAACTATATTGTTGC -3'
(R):5'- ATTTGTGCTCTTAAGTAATTGCTCTC -3'
Posted On2016-07-06