Incidental Mutation 'R5264:Fbxl21'
ID401619
Institutional Source Beutler Lab
Gene Symbol Fbxl21
Ensembl Gene ENSMUSG00000035509
Gene NameF-box and leucine-rich repeat protein 21
SynonymsD630045D17Rik, FBL3B, FBXL3B, Psttm
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56522472-56537898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56532323 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 174 (F174L)
Ref Sequence ENSEMBL: ENSMUSP00000035248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000121095] [ENSMUST00000121871] [ENSMUST00000124981] [ENSMUST00000128668]
Predicted Effect probably benign
Transcript: ENSMUST00000045428
AA Change: F174L

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509
AA Change: F174L

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121095
SMART Domains Protein: ENSMUSP00000112714
Gene: ENSMUSG00000035509

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121871
AA Change: F200L

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509
AA Change: F200L

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124981
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice with a point mutation exhibit a short circadian free-running period in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Fbxl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Fbxl21 APN 13 56527709 splice site probably benign
IGL01972:Fbxl21 APN 13 56536859 nonsense probably null
IGL02450:Fbxl21 APN 13 56526953 missense possibly damaging 0.52
IGL02667:Fbxl21 APN 13 56537129 missense probably benign 0.07
IGL02945:Fbxl21 APN 13 56527170 missense probably damaging 1.00
R1535:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R1741:Fbxl21 UTSW 13 56537102 missense probably benign 0.06
R1863:Fbxl21 UTSW 13 56527063 missense probably benign 0.01
R1886:Fbxl21 UTSW 13 56527093 missense probably benign 0.24
R3176:Fbxl21 UTSW 13 56537122 nonsense probably null
R3276:Fbxl21 UTSW 13 56537122 nonsense probably null
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3733:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R4535:Fbxl21 UTSW 13 56527060 missense probably damaging 0.99
R4678:Fbxl21 UTSW 13 56537049 missense probably damaging 1.00
R5640:Fbxl21 UTSW 13 56537381 missense probably benign 0.23
R5714:Fbxl21 UTSW 13 56527072 missense probably benign 0.29
R6640:Fbxl21 UTSW 13 56537009 missense probably damaging 1.00
R6989:Fbxl21 UTSW 13 56527061 missense probably damaging 1.00
R7140:Fbxl21 UTSW 13 56532332 missense probably damaging 1.00
R7180:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
X0019:Fbxl21 UTSW 13 56532429 missense possibly damaging 0.82
X0026:Fbxl21 UTSW 13 56527112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCTACTGGCTAGTGATGC -3'
(R):5'- CAAAGGCATGTGCTTTTCAATAAGC -3'

Sequencing Primer
(F):5'- GCTAGTGATGCCATGACAACC -3'
(R):5'- TGAAACGTGAGGACAGCT -3'
Posted On2016-07-06