Incidental Mutation 'R5265:St3gal5'
ID401646
Institutional Source Beutler Lab
Gene Symbol St3gal5
Ensembl Gene ENSMUSG00000056091
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 5
SynonymsGM3-specific sialytransferase, 3S-T, mST3Gal V, ST3Gal V, GM3 synthase, Siat9, [a]2
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72097592-72154571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72149131 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 320 (I320N)
Ref Sequence ENSEMBL: ENSMUSP00000070414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069994] [ENSMUST00000114112]
Predicted Effect probably damaging
Transcript: ENSMUST00000069994
AA Change: I320N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070414
Gene: ENSMUSG00000056091
AA Change: I320N

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:Glyco_transf_29 141 411 3e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114112
AA Change: I293N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109747
Gene: ENSMUSG00000056091
AA Change: I293N

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Glyco_transf_29 111 385 4.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187007
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ganglioside GM3 is known to participate in the induction of cell differentiation, modulation of cell proliferation, maintenance of fibroblast morphology, signal transduction, and integrin-mediated cell adhesion. The protein encoded by this gene is a type II membrane protein which catalyzes the formation of GM3 using lactosylceramide as the substrate. The encoded protein is a member of glycosyltransferase family 29 and may be localized to the Golgi apparatus. Mutation in this gene has been associated with Amish infantile epilepsy syndrome. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to inability to synthesize GM3 ganglioside. Homozygotes for a null allele exhibit enhanced sensitivity to insulin. Homozygotes for a different null allele show resistance to botulinum neurotoxin type C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in St3gal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:St3gal5 APN 6 72128282 missense probably benign 0.00
IGL02277:St3gal5 APN 6 72142200 missense possibly damaging 0.50
IGL02756:St3gal5 APN 6 72149173 missense probably null 0.83
IGL02904:St3gal5 APN 6 72147124 missense possibly damaging 0.94
R0107:St3gal5 UTSW 6 72142149 missense probably benign 0.11
R1605:St3gal5 UTSW 6 72142288 missense probably benign 0.42
R1854:St3gal5 UTSW 6 72132093 missense probably damaging 1.00
R2875:St3gal5 UTSW 6 72147130 missense possibly damaging 0.96
R3692:St3gal5 UTSW 6 72149029 missense probably benign 0.05
R5071:St3gal5 UTSW 6 72132053 missense probably damaging 1.00
R5609:St3gal5 UTSW 6 72153462 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACCGCTGTTGACAGGATGAC -3'
(R):5'- GGTTTCCCTACTACAGATGCTTCTAG -3'

Sequencing Primer
(F):5'- CCGCTGTTGACAGGATGACATTAC -3'
(R):5'- GACATTCGCTTCCCAAAAGGGTTG -3'
Posted On2016-07-06