Incidental Mutation 'R5265:Dmwd'
ID401651
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19080281 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 285 (N285K)
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000032570
AA Change: N285K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410
AA Change: N285K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108479
AA Change: N285K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410
AA Change: N285K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Meta Mutation Damage Score 0.0448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 unclassified probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R4937:Dmwd UTSW 7 19081303 critical splice donor site probably null
R5018:Dmwd UTSW 7 19078119 missense probably damaging 0.99
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5165:Dmwd UTSW 7 19078035 intron probably benign
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R6695:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R7106:Dmwd UTSW 7 19080529 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGAAGTGGCTGCCTGAGTC -3'
(R):5'- CACAGTGACTAAGTCATCTTCCC -3'

Sequencing Primer
(F):5'- CCTGAGTCAGAGAGTCTGTTCC -3'
(R):5'- CCTCCTGTCACCACGTAGCG -3'
Posted On2016-07-06