Incidental Mutation 'R5265:Olfr497'
ID401654
Institutional Source Beutler Lab
Gene Symbol Olfr497
Ensembl Gene ENSMUSG00000095239
Gene Nameolfactory receptor 497
SynonymsGA_x6K02T2PBJ9-10752603-10753547, MOR204-9
MMRRC Submission 042833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5265 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108420421-108424911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108423402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 277 (V277E)
Ref Sequence ENSEMBL: ENSMUSP00000150439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076406] [ENSMUST00000213521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076406
AA Change: V277E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075741
Gene: ENSMUSG00000095239
AA Change: V277E

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 5.5e-55 PFAM
Pfam:7tm_1 44 293 1.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211454
AA Change: V277E
Predicted Effect possibly damaging
Transcript: ENSMUST00000213521
AA Change: V277E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Scg5 A T 2: 113,776,865 L192* probably null Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Olfr497
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr497 APN 7 108423028 nonsense probably null
IGL03145:Olfr497 APN 7 108422599 missense probably benign 0.00
R0732:Olfr497 UTSW 7 108422577 missense probably benign 0.00
R1892:Olfr497 UTSW 7 108422940 missense possibly damaging 0.61
R2008:Olfr497 UTSW 7 108423182 missense probably benign 0.01
R3721:Olfr497 UTSW 7 108423119 missense probably damaging 1.00
R4497:Olfr497 UTSW 7 108422915 missense probably benign 0.37
R4674:Olfr497 UTSW 7 108423102 missense possibly damaging 0.65
R4675:Olfr497 UTSW 7 108423102 missense possibly damaging 0.65
R4695:Olfr497 UTSW 7 108422989 missense probably benign 0.18
R5656:Olfr497 UTSW 7 108422618 missense probably benign 0.03
R5758:Olfr497 UTSW 7 108423162 missense probably benign 0.02
R6124:Olfr497 UTSW 7 108423518 unclassified probably null
R6787:Olfr497 UTSW 7 108422682 missense possibly damaging 0.52
R7174:Olfr497 UTSW 7 108423160 missense probably benign 0.01
R7222:Olfr497 UTSW 7 108422637 missense probably benign 0.00
R7240:Olfr497 UTSW 7 108422933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCTCAGTTACTATGATCAC -3'
(R):5'- CAACTTGAGATCGTGGTCATATTGG -3'

Sequencing Primer
(F):5'- ACAGTGTTTGTAATAGCTGTCTCC -3'
(R):5'- AGATCGTGGTCATATTGGTCTTGC -3'
Posted On2016-07-06