Incidental Mutation 'R5266:Vnn1'
ID 401709
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Name vanin 1
Synonyms V-1, pantetheinase
MMRRC Submission 042858-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R5266 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 23770586-23781241 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 23779303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 404 (C404Y)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
AlphaFold Q9Z0K8
Predicted Effect probably damaging
Transcript: ENSMUST00000041416
AA Change: C404Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: C404Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Meta Mutation Damage Score 0.8843 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,591,455 (GRCm39) N457S probably damaging Het
Asic4 G A 1: 75,427,567 (GRCm39) G31E probably benign Het
Atp2a3 A G 11: 72,866,223 (GRCm39) D281G probably damaging Het
Azin1 T C 15: 38,491,795 (GRCm39) D387G probably benign Het
Bdp1 T C 13: 100,204,043 (GRCm39) M660V probably benign Het
Catsperg2 G A 7: 29,416,491 (GRCm39) T307M probably damaging Het
Cfap54 T G 10: 92,651,764 (GRCm39) K3095N probably benign Het
Chl1 A G 6: 103,677,504 (GRCm39) N706S probably damaging Het
Crym A G 7: 119,798,517 (GRCm39) V113A probably benign Het
Cux1 A G 5: 136,341,548 (GRCm39) S607P probably damaging Het
Cyp3a44 T C 5: 145,731,207 (GRCm39) N198D possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Elac1 A G 18: 73,875,740 (GRCm39) V97A probably benign Het
Erbb3 G A 10: 128,405,505 (GRCm39) T1251M probably damaging Het
Gask1b T A 3: 79,843,910 (GRCm39) N12K probably damaging Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hydin A G 8: 111,061,416 (GRCm39) H316R possibly damaging Het
Ikzf3 A T 11: 98,381,406 (GRCm39) M58K probably benign Het
Lyst T C 13: 13,835,555 (GRCm39) Y1746H probably damaging Het
Map3k11 T A 19: 5,750,622 (GRCm39) N613K probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mrm1 A T 11: 84,710,086 (GRCm39) L38Q possibly damaging Het
Myo7b A G 18: 32,131,787 (GRCm39) F470L probably damaging Het
Ndst2 G A 14: 20,774,555 (GRCm39) R834W probably damaging Het
Opa1 T A 16: 29,436,948 (GRCm39) I637N probably benign Het
Or52h9 A T 7: 104,203,026 (GRCm39) Q300L probably benign Het
Or5d43 T C 2: 88,104,565 (GRCm39) Y276C possibly damaging Het
Padi4 A G 4: 140,473,442 (GRCm39) V665A possibly damaging Het
Pcdh1 A G 18: 38,325,252 (GRCm39) Y897H probably damaging Het
Pkp3 A G 7: 140,663,190 (GRCm39) D345G probably damaging Het
Pla2g4a T C 1: 149,740,918 (GRCm39) M366V possibly damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pon3 T C 6: 5,240,860 (GRCm39) D34G possibly damaging Het
Ppargc1b A T 18: 61,448,876 (GRCm39) S133T probably damaging Het
Ppp4r3b T C 11: 29,123,309 (GRCm39) S2P possibly damaging Het
Rbm20 A G 19: 53,801,818 (GRCm39) T109A probably damaging Het
Rexo5 C A 7: 119,443,660 (GRCm39) H690Q probably benign Het
Scube2 C T 7: 109,408,437 (GRCm39) G670D probably damaging Het
Sipa1l2 T C 8: 126,218,865 (GRCm39) I157M probably damaging Het
Slbp A T 5: 33,801,210 (GRCm39) I167N probably damaging Het
Sry C G Y: 2,662,975 (GRCm39) Q228H unknown Het
Stk36 T C 1: 74,650,317 (GRCm39) V283A probably benign Het
Tead1 A G 7: 112,358,673 (GRCm39) probably benign Het
Tecpr2 G C 12: 110,881,836 (GRCm39) W135S probably damaging Het
Tha1 A C 11: 117,760,502 (GRCm39) S241A probably damaging Het
Ttc39a A T 4: 109,279,701 (GRCm39) I112F probably benign Het
Vmn1r128 A T 7: 21,083,328 (GRCm39) T11S probably benign Het
Wdr41 T C 13: 95,131,759 (GRCm39) F57L probably damaging Het
Zfp975 T G 7: 42,311,654 (GRCm39) T320P probably damaging Het
Zfp985 A T 4: 147,667,289 (GRCm39) probably null Het
Zfpm2 T C 15: 40,962,865 (GRCm39) S176P probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23,776,677 (GRCm39) missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23,770,949 (GRCm39) missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23,776,738 (GRCm39) missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23,776,608 (GRCm39) missense probably benign 0.26
IGL01970:Vnn1 APN 10 23,773,300 (GRCm39) missense probably benign 0.06
IGL01985:Vnn1 APN 10 23,776,642 (GRCm39) missense probably benign 0.00
IGL02019:Vnn1 APN 10 23,779,449 (GRCm39) missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23,779,323 (GRCm39) missense probably benign 0.00
IGL02349:Vnn1 APN 10 23,774,401 (GRCm39) missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23,780,520 (GRCm39) missense probably benign 0.00
IGL03058:Vnn1 APN 10 23,780,442 (GRCm39) missense probably benign 0.06
R0008:Vnn1 UTSW 10 23,774,500 (GRCm39) critical splice donor site probably null
R0030:Vnn1 UTSW 10 23,776,744 (GRCm39) missense probably benign 0.08
R0508:Vnn1 UTSW 10 23,770,910 (GRCm39) missense probably benign 0.01
R0781:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23,776,727 (GRCm39) missense probably benign 0.00
R1757:Vnn1 UTSW 10 23,776,726 (GRCm39) missense possibly damaging 0.49
R1778:Vnn1 UTSW 10 23,775,415 (GRCm39) missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23,770,869 (GRCm39) nonsense probably null
R2055:Vnn1 UTSW 10 23,776,475 (GRCm39) splice site probably benign
R2158:Vnn1 UTSW 10 23,776,653 (GRCm39) nonsense probably null
R2186:Vnn1 UTSW 10 23,773,299 (GRCm39) missense probably benign 0.29
R4277:Vnn1 UTSW 10 23,774,410 (GRCm39) missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23,774,410 (GRCm39) missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23,770,789 (GRCm39) missense probably benign
R4590:Vnn1 UTSW 10 23,775,303 (GRCm39) missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23,773,250 (GRCm39) missense probably benign 0.01
R4794:Vnn1 UTSW 10 23,776,602 (GRCm39) missense probably benign 0.01
R5495:Vnn1 UTSW 10 23,774,462 (GRCm39) missense probably damaging 0.98
R6064:Vnn1 UTSW 10 23,770,807 (GRCm39) missense probably benign 0.05
R7081:Vnn1 UTSW 10 23,770,903 (GRCm39) missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23,776,645 (GRCm39) missense probably benign 0.00
R7221:Vnn1 UTSW 10 23,770,952 (GRCm39) missense probably benign 0.07
R7334:Vnn1 UTSW 10 23,776,658 (GRCm39) missense probably benign 0.04
R8784:Vnn1 UTSW 10 23,780,526 (GRCm39) missense probably benign
R8859:Vnn1 UTSW 10 23,780,484 (GRCm39) missense probably benign 0.01
R8926:Vnn1 UTSW 10 23,776,587 (GRCm39) missense probably benign 0.04
R8987:Vnn1 UTSW 10 23,776,714 (GRCm39) missense probably damaging 0.98
R9002:Vnn1 UTSW 10 23,775,349 (GRCm39) missense possibly damaging 0.82
R9091:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9270:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9276:Vnn1 UTSW 10 23,776,794 (GRCm39) missense probably damaging 1.00
R9453:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
R9557:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCACTAAAGATGCAGAGGG -3'
(R):5'- ATCAAGCGGAGAGTGTTACC -3'

Sequencing Primer
(F):5'- GCGGCCCTGATTATAAAGTTCAGC -3'
(R):5'- GGAGAGTGTTACCTGAAACTCCC -3'
Posted On 2016-07-06