Incidental Mutation 'R0414:Fbxo22'
ID40173
Institutional Source Beutler Lab
Gene Symbol Fbxo22
Ensembl Gene ENSMUSG00000032309
Gene NameF-box protein 22
Synonyms
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location55208925-55224433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55223626 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 393 (M393K)
Ref Sequence ENSEMBL: ENSMUSP00000034859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034859] [ENSMUST00000130158] [ENSMUST00000133795] [ENSMUST00000135531] [ENSMUST00000137675] [ENSMUST00000140375] [ENSMUST00000145784] [ENSMUST00000146201] [ENSMUST00000153970] [ENSMUST00000164721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034859
AA Change: M393K

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034859
Gene: ENSMUSG00000032309
AA Change: M393K

DomainStartEndE-ValueType
Pfam:F-box 22 66 1.7e-6 PFAM
FIST_C 231 365 2.61e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126368
Predicted Effect probably benign
Transcript: ENSMUST00000130158
SMART Domains Protein: ENSMUSP00000115247
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
EGF 8 46 4.78e-3 SMART
transmembrane domain 61 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133795
Predicted Effect probably benign
Transcript: ENSMUST00000135531
Predicted Effect probably benign
Transcript: ENSMUST00000137675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139261
Predicted Effect probably benign
Transcript: ENSMUST00000140375
SMART Domains Protein: ENSMUSP00000117341
Gene: ENSMUSG00000032309

DomainStartEndE-ValueType
Pfam:F-box 21 66 3e-8 PFAM
Pfam:F-box-like 26 66 4.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144939
Predicted Effect probably benign
Transcript: ENSMUST00000145784
SMART Domains Protein: ENSMUSP00000115851
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
Blast:EGF 8 35 9e-13 BLAST
SCOP:d1jl9a_ 9 35 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146201
AA Change: M290K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117106
Gene: ENSMUSG00000032309
AA Change: M290K

DomainStartEndE-ValueType
FIST_C 128 262 2.61e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153970
Predicted Effect probably benign
Transcript: ENSMUST00000164721
SMART Domains Protein: ENSMUSP00000130929
Gene: ENSMUSG00000032311

DomainStartEndE-ValueType
EGF 8 46 4.78e-3 SMART
transmembrane domain 61 83 N/A INTRINSIC
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and, as a transcriptional target of the tumor protein p53, is thought to be involved in degradation of specific proteins in response to p53 induction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Fbxo22
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Fbxo22 UTSW 9 55221070 unclassified probably null
FR4737:Fbxo22 UTSW 9 55209382 missense probably damaging 1.00
R0112:Fbxo22 UTSW 9 55223346 missense probably benign 0.00
R0634:Fbxo22 UTSW 9 55214960 missense probably benign 0.43
R0694:Fbxo22 UTSW 9 55221139 missense probably damaging 0.99
R1799:Fbxo22 UTSW 9 55223487 missense probably benign 0.00
R1958:Fbxo22 UTSW 9 55209342 unclassified probably null
R2060:Fbxo22 UTSW 9 55218383 missense probably damaging 0.97
R2850:Fbxo22 UTSW 9 55223415 missense probably damaging 1.00
R3883:Fbxo22 UTSW 9 55223262 missense probably benign
R4649:Fbxo22 UTSW 9 55221049 missense probably damaging 1.00
R5829:Fbxo22 UTSW 9 55218312 splice site probably null
R7260:Fbxo22 UTSW 9 55218470 missense probably benign 0.00
R7329:Fbxo22 UTSW 9 55214977 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGAACAGAACACCATTGGCTTC -3'
(R):5'- TCATCCCAAAGTGACCTCAGAGCG -3'

Sequencing Primer
(F):5'- CCGAGGCTTTCAGTACTACAGAG -3'
(R):5'- TGACCTCAGAGCGTCACC -3'
Posted On2013-05-23