Incidental Mutation 'R5267:Pde4d'
ID401799
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 042859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5267 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 109260809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000120671
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138938
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: S52A
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: S52A

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177907
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,584,857 F509S probably damaging Het
Abca12 T A 1: 71,335,774 probably benign Het
Adam15 T G 3: 89,349,899 probably benign Het
Atp12a T C 14: 56,384,211 S768P probably damaging Het
Atp8a1 G A 5: 67,762,544 T393I probably damaging Het
B4galnt4 T G 7: 141,070,611 I3S probably damaging Het
Bfsp1 G A 2: 143,827,051 T536I probably benign Het
Brsk1 G T 7: 4,704,709 W284L probably damaging Het
C87977 A T 4: 144,213,005 probably benign Het
Cadm3 A T 1: 173,337,102 D370E probably damaging Het
Cadps2 A G 6: 23,626,668 I207T possibly damaging Het
Calr4 A C 4: 109,244,076 T52P probably damaging Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Ckap5 T A 2: 91,591,752 N1166K probably null Het
Clca4a G A 3: 144,953,812 T761I probably damaging Het
Cnksr3 A T 10: 7,126,633 probably null Het
Diaph3 A G 14: 86,656,553 S7P probably benign Het
Dnah7a G A 1: 53,479,692 P2969S probably damaging Het
Dnaic2 A T 11: 114,740,467 T221S probably benign Het
Dsc2 A G 18: 20,034,583 probably null Het
Eif4g1 A G 16: 20,685,533 N789S probably damaging Het
Fn1 C T 1: 71,629,704 R694H probably damaging Het
Gm5478 G A 15: 101,644,402 R365C probably damaging Het
Gm5591 A T 7: 38,518,914 M845K possibly damaging Het
Gm5800 A T 14: 51,713,837 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Q2 A T 17: 35,343,179 Y134F probably benign Het
Hcfc1r1 A G 17: 23,674,674 R76G possibly damaging Het
Hectd4 T C 5: 121,344,824 I3146T probably benign Het
Herc1 G T 9: 66,461,809 L2928F probably damaging Het
Hmx3 C T 7: 131,544,169 A202V probably benign Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Il20ra A G 10: 19,749,359 T129A probably damaging Het
Il21 T C 3: 37,227,797 H66R probably benign Het
Kcnh5 A T 12: 75,087,416 M453K probably damaging Het
Kdf1 C G 4: 133,528,947 A325G probably damaging Het
Klhl10 C T 11: 100,447,221 A262V probably benign Het
Krt81 T A 15: 101,459,459 N464I probably benign Het
Ksr1 A T 11: 79,020,425 I698N probably damaging Het
Lrp2 A G 2: 69,548,978 V130A possibly damaging Het
Mcm2 T C 6: 88,897,450 T25A probably benign Het
Mrps18c T A 5: 100,803,094 Y93* probably null Het
Mycl C T 4: 123,000,496 A363V probably damaging Het
Mylk2 C A 2: 152,913,549 A211E probably benign Het
Myo5a G A 9: 75,152,010 D507N probably damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Oas1a A T 5: 120,899,221 C248S probably benign Het
Olfr1036 T A 2: 86,075,538 V266E probably benign Het
Olfr1229 C T 2: 89,282,230 W301* probably null Het
Olfr1471 A G 19: 13,445,111 Y33C probably damaging Het
Olfr26 G A 9: 38,855,805 V248M probably damaging Het
Olfr492 A G 7: 108,322,978 S233P probably damaging Het
Olfr612 T C 7: 103,538,824 I137V probably benign Het
Olfr701 T C 7: 106,818,808 S242P probably damaging Het
Otub1 C A 19: 7,199,992 G67C probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr8 A G 1: 20,934,696 I25V probably benign Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pdzd8 C A 19: 59,301,026 K647N probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Praf2 T C X: 7,730,402 probably benign Het
Psg25 A T 7: 18,524,786 Y322N possibly damaging Het
Rxrg A G 1: 167,635,766 E402G probably damaging Het
Selenok T A 14: 29,970,065 V20E probably benign Het
Sipa1 G A 19: 5,655,758 T394I probably benign Het
Spag17 A T 3: 100,061,948 N1247I probably damaging Het
Spata31d1c A G 13: 65,035,904 D420G probably damaging Het
Syk A G 13: 52,641,926 K519R probably benign Het
Syne2 A T 12: 75,938,741 E1654D possibly damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Thsd7a T A 6: 12,379,602 E941V probably damaging Het
Tjp1 T C 7: 65,323,049 T548A probably damaging Het
Tube1 C A 10: 39,144,556 D210E probably benign Het
Vmn1r183 T A 7: 24,055,546 I258N possibly damaging Het
Vmn1r89 A T 7: 13,220,213 N292I probably damaging Het
Vmp1 C A 11: 86,663,551 V79L probably benign Het
Zfp182 T A X: 21,036,366 D125V possibly damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Znrf1 G A 8: 111,537,267 A43T probably benign Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTCCTCAGACTCCGGATC -3'
(R):5'- GGTATGGCTAACATTTCAGGGG -3'

Sequencing Primer
(F):5'- AGACTCCGGATCAAGGGACTC -3'
(R):5'- GTCGGTGCAGACCTTACCATG -3'
Posted On2016-07-06