Incidental Mutation 'R5267:Eif4g1'
ID401806
Institutional Source Beutler Lab
Gene Symbol Eif4g1
Ensembl Gene ENSMUSG00000045983
Gene Nameeukaryotic translation initiation factor 4, gamma 1
SynonymsE030015G23Rik
MMRRC Submission 042859-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.975) question?
Stock #R5267 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20668313-20692884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20685533 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 789 (N789S)
Ref Sequence ENSEMBL: ENSMUSP00000144320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000128594] [ENSMUST00000142344] [ENSMUST00000143939] [ENSMUST00000150333] [ENSMUST00000156226]
Predicted Effect probably damaging
Transcript: ENSMUST00000044783
AA Change: N1086S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983
AA Change: N1086S

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073840
AA Change: N1079S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983
AA Change: N1079S

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104051
Predicted Effect probably damaging
Transcript: ENSMUST00000115457
AA Change: N1039S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983
AA Change: N1039S

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115460
AA Change: N1086S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983
AA Change: N1086S

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115461
AA Change: N1080S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983
AA Change: N1080S

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115463
AA Change: N1072S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983
AA Change: N1072S

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128594
SMART Domains Protein: ENSMUSP00000144594
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 5e-11 PDB
low complexity region 89 115 N/A INTRINSIC
low complexity region 265 286 N/A INTRINSIC
low complexity region 293 316 N/A INTRINSIC
Blast:MIF4G 467 512 4e-9 BLAST
low complexity region 514 536 N/A INTRINSIC
MIF4G 594 795 1.1e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137690
Predicted Effect probably benign
Transcript: ENSMUST00000142344
SMART Domains Protein: ENSMUSP00000116029
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 5e-11 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 672 6e-8 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 958 5.49e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143939
AA Change: N789S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983
AA Change: N789S

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150333
SMART Domains Protein: ENSMUSP00000144107
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 113 140 5e-11 PDB
low complexity region 194 220 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 398 421 N/A INTRINSIC
Blast:MIF4G 572 613 9e-8 BLAST
low complexity region 619 641 N/A INTRINSIC
MIF4G 699 900 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231477
Predicted Effect probably benign
Transcript: ENSMUST00000231598
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: This gene encodes a member of the eukaryotic translation initiation factors (eIF) that play important roles in translation initiation by mediating recruitment of additional initiation factors and providing a scaffold for ribosome/mRNA-bridging. Along with eIF4A and eIF4E, the encoded protein forms the eIF4F complex that bridges the 5' UTR with the polyadenylated 3' UTR resulting in mRNA circularization, enhanced translation initiation and mRNA stability. Through its association with eIF3, the encoded protein mediates recruitment of the 43S pre-initiation complex to mRNA. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes for this gene have been identified on chromosomes 2 and 13. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an amino acid substitution (R1207H) are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,584,857 F509S probably damaging Het
Abca12 T A 1: 71,335,774 probably benign Het
Adam15 T G 3: 89,349,899 probably benign Het
Atp12a T C 14: 56,384,211 S768P probably damaging Het
Atp8a1 G A 5: 67,762,544 T393I probably damaging Het
B4galnt4 T G 7: 141,070,611 I3S probably damaging Het
Bfsp1 G A 2: 143,827,051 T536I probably benign Het
Brsk1 G T 7: 4,704,709 W284L probably damaging Het
C87977 A T 4: 144,213,005 probably benign Het
Cadm3 A T 1: 173,337,102 D370E probably damaging Het
Cadps2 A G 6: 23,626,668 I207T possibly damaging Het
Calr4 A C 4: 109,244,076 T52P probably damaging Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Ckap5 T A 2: 91,591,752 N1166K probably null Het
Clca4a G A 3: 144,953,812 T761I probably damaging Het
Cnksr3 A T 10: 7,126,633 probably null Het
Diaph3 A G 14: 86,656,553 S7P probably benign Het
Dnah7a G A 1: 53,479,692 P2969S probably damaging Het
Dnaic2 A T 11: 114,740,467 T221S probably benign Het
Dsc2 A G 18: 20,034,583 probably null Het
Fn1 C T 1: 71,629,704 R694H probably damaging Het
Gm5478 G A 15: 101,644,402 R365C probably damaging Het
Gm5591 A T 7: 38,518,914 M845K possibly damaging Het
Gm5800 A T 14: 51,713,837 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
H2-Q2 A T 17: 35,343,179 Y134F probably benign Het
Hcfc1r1 A G 17: 23,674,674 R76G possibly damaging Het
Hectd4 T C 5: 121,344,824 I3146T probably benign Het
Herc1 G T 9: 66,461,809 L2928F probably damaging Het
Hmx3 C T 7: 131,544,169 A202V probably benign Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Il20ra A G 10: 19,749,359 T129A probably damaging Het
Il21 T C 3: 37,227,797 H66R probably benign Het
Kcnh5 A T 12: 75,087,416 M453K probably damaging Het
Kdf1 C G 4: 133,528,947 A325G probably damaging Het
Klhl10 C T 11: 100,447,221 A262V probably benign Het
Krt81 T A 15: 101,459,459 N464I probably benign Het
Ksr1 A T 11: 79,020,425 I698N probably damaging Het
Lrp2 A G 2: 69,548,978 V130A possibly damaging Het
Mcm2 T C 6: 88,897,450 T25A probably benign Het
Mrps18c T A 5: 100,803,094 Y93* probably null Het
Mycl C T 4: 123,000,496 A363V probably damaging Het
Mylk2 C A 2: 152,913,549 A211E probably benign Het
Myo5a G A 9: 75,152,010 D507N probably damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Oas1a A T 5: 120,899,221 C248S probably benign Het
Olfr1036 T A 2: 86,075,538 V266E probably benign Het
Olfr1229 C T 2: 89,282,230 W301* probably null Het
Olfr1471 A G 19: 13,445,111 Y33C probably damaging Het
Olfr26 G A 9: 38,855,805 V248M probably damaging Het
Olfr492 A G 7: 108,322,978 S233P probably damaging Het
Olfr612 T C 7: 103,538,824 I137V probably benign Het
Olfr701 T C 7: 106,818,808 S242P probably damaging Het
Otub1 C A 19: 7,199,992 G67C probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr8 A G 1: 20,934,696 I25V probably benign Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pde4d T G 13: 109,260,809 probably benign Het
Pdzd8 C A 19: 59,301,026 K647N probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Praf2 T C X: 7,730,402 probably benign Het
Psg25 A T 7: 18,524,786 Y322N possibly damaging Het
Rxrg A G 1: 167,635,766 E402G probably damaging Het
Selenok T A 14: 29,970,065 V20E probably benign Het
Sipa1 G A 19: 5,655,758 T394I probably benign Het
Spag17 A T 3: 100,061,948 N1247I probably damaging Het
Spata31d1c A G 13: 65,035,904 D420G probably damaging Het
Syk A G 13: 52,641,926 K519R probably benign Het
Syne2 A T 12: 75,938,741 E1654D possibly damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Thsd7a T A 6: 12,379,602 E941V probably damaging Het
Tjp1 T C 7: 65,323,049 T548A probably damaging Het
Tube1 C A 10: 39,144,556 D210E probably benign Het
Vmn1r183 T A 7: 24,055,546 I258N possibly damaging Het
Vmn1r89 A T 7: 13,220,213 N292I probably damaging Het
Vmp1 C A 11: 86,663,551 V79L probably benign Het
Zfp182 T A X: 21,036,366 D125V possibly damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Znrf1 G A 8: 111,537,267 A43T probably benign Het
Other mutations in Eif4g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Eif4g1 APN 16 20686754 intron probably benign
IGL00707:Eif4g1 APN 16 20689014 missense probably damaging 1.00
IGL00950:Eif4g1 APN 16 20683628 missense probably damaging 1.00
IGL01397:Eif4g1 APN 16 20679675 missense probably damaging 0.98
IGL01657:Eif4g1 APN 16 20682216 missense possibly damaging 0.94
IGL01875:Eif4g1 APN 16 20681040 missense probably damaging 0.96
IGL02728:Eif4g1 APN 16 20686752 intron probably benign
IGL03155:Eif4g1 APN 16 20692417 missense probably damaging 1.00
IGL03339:Eif4g1 APN 16 20680984 missense possibly damaging 0.72
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0138:Eif4g1 UTSW 16 20675345 missense probably damaging 0.99
R0556:Eif4g1 UTSW 16 20675794 missense probably damaging 0.99
R0576:Eif4g1 UTSW 16 20684068 missense probably damaging 0.98
R1424:Eif4g1 UTSW 16 20678942 missense probably benign 0.03
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1487:Eif4g1 UTSW 16 20678873 unclassified probably benign
R1659:Eif4g1 UTSW 16 20681061 missense probably damaging 0.99
R1697:Eif4g1 UTSW 16 20679780 missense probably damaging 0.99
R1848:Eif4g1 UTSW 16 20681867 missense probably damaging 1.00
R1855:Eif4g1 UTSW 16 20687161 missense possibly damaging 0.77
R1865:Eif4g1 UTSW 16 20678648 missense probably damaging 0.99
R3001:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R3002:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R4402:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4477:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4478:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4479:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4480:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4623:Eif4g1 UTSW 16 20681345 unclassified probably benign
R4658:Eif4g1 UTSW 16 20685934 missense possibly damaging 0.78
R4751:Eif4g1 UTSW 16 20686515 missense possibly damaging 0.89
R4859:Eif4g1 UTSW 16 20682173 missense probably benign 0.44
R5376:Eif4g1 UTSW 16 20683827 missense probably damaging 1.00
R5560:Eif4g1 UTSW 16 20686895 missense probably benign
R5719:Eif4g1 UTSW 16 20689011 missense probably damaging 1.00
R6632:Eif4g1 UTSW 16 20685520 missense probably damaging 0.99
R6849:Eif4g1 UTSW 16 20680745 missense probably benign 0.08
R7134:Eif4g1 UTSW 16 20681502 missense probably damaging 1.00
X0062:Eif4g1 UTSW 16 20684501 missense probably damaging 1.00
X0065:Eif4g1 UTSW 16 20682726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTGAATTTTACTGTCTATGGG -3'
(R):5'- GGCATCATGTATAACTCCTACATTT -3'

Sequencing Primer
(F):5'- ctgtggattgtaaagccc -3'
(R):5'- CTCCATACCTGTGTCTGA -3'
Posted On2016-07-06