Incidental Mutation 'R4650:Kirrel1'
ID 401848
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4650 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86996458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 88,860,603 (GRCm39) Y77F unknown Het
4933409G03Rik G A 2: 68,436,559 (GRCm39) E168K unknown Het
Aldoa A G 7: 126,396,879 (GRCm39) S71P possibly damaging Het
Arhgef12 A G 9: 42,893,266 (GRCm39) V979A probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Brd8 T C 18: 34,739,752 (GRCm39) T674A probably benign Het
Cacna1d C T 14: 29,817,365 (GRCm39) M1232I probably benign Het
Capza1 A G 3: 104,752,296 (GRCm39) V14A probably damaging Het
Cdk2 A T 10: 128,538,364 (GRCm39) I135N probably damaging Het
Celf4 A T 18: 25,629,302 (GRCm39) M407K possibly damaging Het
Cenpf A T 1: 189,392,235 (GRCm39) D532E probably benign Het
Cideb A G 14: 55,992,688 (GRCm39) V76A possibly damaging Het
Dbpht2 C G 12: 74,345,933 (GRCm39) noncoding transcript Het
Dis3l2 A G 1: 86,918,043 (GRCm39) D550G possibly damaging Het
Dnah1 A T 14: 31,006,844 (GRCm39) probably null Het
Edc4 T A 8: 106,619,307 (GRCm39) L1293* probably null Het
Elp5 A G 11: 69,860,398 (GRCm39) V203A possibly damaging Het
Fndc7 T C 3: 108,770,135 (GRCm39) N597S probably benign Het
Gjb3 T C 4: 127,220,484 (GRCm39) Y16C probably damaging Het
Gm5773 A G 3: 93,680,712 (GRCm39) D128G probably benign Het
Gnb1l T C 16: 18,363,025 (GRCm39) probably null Het
Gon4l G A 3: 88,770,859 (GRCm39) D514N possibly damaging Het
Grhl3 T A 4: 135,276,547 (GRCm39) probably null Het
Hoxc10 T C 15: 102,875,698 (GRCm39) S136P probably benign Het
Ift22 G A 5: 136,940,655 (GRCm39) V107I probably benign Het
Lamc1 T G 1: 153,104,523 (GRCm39) S59R probably damaging Het
Lgi4 G A 7: 30,768,554 (GRCm39) A518T probably benign Het
Lhx2 T A 2: 38,250,052 (GRCm39) N290K probably damaging Het
Ltbp4 A T 7: 27,013,734 (GRCm39) C1092S probably damaging Het
Macf1 T C 4: 123,367,412 (GRCm39) I2450V probably benign Het
Mefv A G 16: 3,535,682 (GRCm39) L82P probably damaging Het
Myb A G 10: 21,028,840 (GRCm39) L86P probably damaging Het
Myh3 C T 11: 66,977,270 (GRCm39) T333M probably damaging Het
Nek11 T C 9: 105,225,279 (GRCm39) N78D possibly damaging Het
Nmi C A 2: 51,838,646 (GRCm39) C296F probably benign Het
Nphs1 A T 7: 30,181,895 (GRCm39) T1163S probably benign Het
Npy4r C T 14: 33,868,181 (GRCm39) G369D possibly damaging Het
Ola1 T C 2: 72,972,309 (GRCm39) T221A probably damaging Het
Or51d1 A G 7: 102,348,027 (GRCm39) D194G probably damaging Het
Or8c11 T C 9: 38,289,699 (GRCm39) F168S probably damaging Het
Pfkfb2 A T 1: 130,633,200 (GRCm39) N184K possibly damaging Het
Plce1 T C 19: 38,513,088 (GRCm39) V129A probably benign Het
Prps2 T C X: 166,135,288 (GRCm39) D183G probably damaging Het
Pth A T 7: 112,985,026 (GRCm39) *116K probably null Het
R3hdm1 T C 1: 128,112,181 (GRCm39) S422P probably damaging Het
Rhox2a G C X: 36,508,962 (GRCm39) R43P probably benign Het
Rwdd3 A G 3: 120,952,826 (GRCm39) F55S probably damaging Het
Serpinb9d A T 13: 33,386,836 (GRCm39) L301F probably benign Het
Slc35e4 A G 11: 3,862,677 (GRCm39) C171R probably damaging Het
Slco1a4 A T 6: 141,758,424 (GRCm39) I529K possibly damaging Het
Styk1 A T 6: 131,277,532 (GRCm39) W370R probably damaging Het
Tmprss11e C A 5: 86,875,212 (GRCm39) W18L probably damaging Het
Trpv1 A C 11: 73,129,089 (GRCm39) E2A probably benign Het
Unc13b T A 4: 43,261,035 (GRCm39) I1799N probably damaging Het
Vmn1r213 G A 13: 23,196,422 (GRCm39) C335Y possibly damaging Het
Vps37c C T 19: 10,690,273 (GRCm39) S245L probably benign Het
Wrn T C 8: 33,745,537 (GRCm39) T1191A probably benign Het
Zfp13 A G 17: 23,799,112 (GRCm39) L153P probably damaging Het
Zfp472 T G 17: 33,196,631 (GRCm39) S235R possibly damaging Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCCTGAGTTCTATGCAAGTC -3'
(R):5'- GCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On 2016-07-14