Incidental Mutation 'R0414:Hist1h1a'
ID40185
Institutional Source Beutler Lab
Gene Symbol Hist1h1a
Ensembl Gene ENSMUSG00000049539
Gene Namehistone cluster 1, H1a
SynonymsH1a, H1f1, H1.1, H1var3
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23763666-23764406 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 23764158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055770] [ENSMUST00000091701] [ENSMUST00000102964]
Predicted Effect unknown
Transcript: ENSMUST00000055770
AA Change: K148E
SMART Domains Protein: ENSMUSP00000062030
Gene: ENSMUSG00000049539
AA Change: K148E

DomainStartEndE-ValueType
H15 36 101 3.22e-22 SMART
low complexity region 120 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091701
SMART Domains Protein: ENSMUSP00000089293
Gene: ENSMUSG00000069265

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102964
SMART Domains Protein: ENSMUSP00000100029
Gene: ENSMUSG00000060093

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any defects in the reproductive system or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Hist1h1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2080:Hist1h1a UTSW 13 23763949 missense possibly damaging 0.81
R5316:Hist1h1a UTSW 13 23764102 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGCTGCTGCAAAGAAGACC -3'
(R):5'- TGTCACTTTCGCCTTGGAAGCC -3'

Sequencing Primer
(F):5'- TTCTTCCAAAGAGCGCAGTG -3'
(R):5'- AGCCTTAGGCTTCACTGC -3'
Posted On2013-05-23