Incidental Mutation 'R0414:Tfeb'
ID40191
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Nametranscription factor EB
SynonymsbHLHe35, TFEB, Tcfeb
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0414 (G1)
Quality Score184
Status Validated
Chromosome17
Chromosomal Location47737030-47792419 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 47788299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
Predicted Effect probably null
Transcript: ENSMUST00000024786
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124765
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140715
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162719
Meta Mutation Damage Score 0.634 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTGACTCAGAAGCGAGAGCTAACAG -3'
(R):5'- TCAGGAAACCAGTCGAGCTACTAGG -3'

Sequencing Primer
(F):5'- CGAGAGCTAACAGGTACTCTGC -3'
(R):5'- ACTGCAATCGGATAGCCTG -3'
Posted On2013-05-23