Incidental Mutation 'R5077:Tmprss11d'
ID401930
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 86309263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]
Predicted Effect probably null
Transcript: ENSMUST00000031175
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122377
SMART Domains Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 47 273 1.29e-86 SMART
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCTCATCTGAGAACTGACAAG -3'
(R):5'- GCTATTTTAGCCCACGACGG -3'

Sequencing Primer
(F):5'- GACTTAGTGGTATAAGCCTGTATCC -3'
(R):5'- GGTACAGCTCCGTAACTCGTGAC -3'
Posted On2016-07-22