Incidental Mutation 'R5077:Eml1'
ID401954
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Nameechinoderm microtubule associated protein like 1
SynonymsA930030P13Rik, ELP79, 1110008N23Rik
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108370957-108539617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 108506612 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
Predicted Effect probably benign
Transcript: ENSMUST00000054955
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109857
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109860
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130999
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155544
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Eml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Eml1 APN 12 108514515 splice site probably null
IGL00774:Eml1 APN 12 108514515 splice site probably null
IGL01358:Eml1 APN 12 108514468 missense probably benign 0.05
IGL02316:Eml1 APN 12 108534759 intron probably benign
IGL02346:Eml1 APN 12 108537441 missense possibly damaging 0.87
IGL02480:Eml1 APN 12 108521696 missense probably benign 0.32
IGL02513:Eml1 APN 12 108530312 missense probably damaging 1.00
IGL02556:Eml1 APN 12 108537366 missense probably benign 0.00
IGL02565:Eml1 APN 12 108506520 missense probably damaging 1.00
IGL03217:Eml1 APN 12 108534942 missense probably benign 0.31
bubble UTSW 12 108513071 critical splice donor site probably null
R0027:Eml1 UTSW 12 108536298 missense possibly damaging 0.90
R0067:Eml1 UTSW 12 108463527 missense possibly damaging 0.61
R0124:Eml1 UTSW 12 108506608 missense probably benign 0.00
R0124:Eml1 UTSW 12 108509178 missense probably damaging 1.00
R0730:Eml1 UTSW 12 108530326 missense possibly damaging 0.79
R1566:Eml1 UTSW 12 108471892 missense probably damaging 0.99
R1883:Eml1 UTSW 12 108463652 missense probably damaging 0.97
R1927:Eml1 UTSW 12 108538217 nonsense probably null
R1938:Eml1 UTSW 12 108521396 missense possibly damaging 0.75
R2070:Eml1 UTSW 12 108512999 missense probably damaging 1.00
R2311:Eml1 UTSW 12 108537416 missense probably damaging 0.99
R2417:Eml1 UTSW 12 108536275 missense probably benign 0.00
R3120:Eml1 UTSW 12 108513053 missense probably benign 0.31
R4352:Eml1 UTSW 12 108534837 intron probably benign
R4471:Eml1 UTSW 12 108506635 intron probably benign
R4655:Eml1 UTSW 12 108534713 missense probably damaging 1.00
R5094:Eml1 UTSW 12 108536311 missense probably benign 0.11
R5113:Eml1 UTSW 12 108537337 missense possibly damaging 0.74
R5524:Eml1 UTSW 12 108521376 missense probably damaging 0.99
R5775:Eml1 UTSW 12 108506554 missense probably damaging 1.00
R6120:Eml1 UTSW 12 108527724 missense probably damaging 1.00
R6224:Eml1 UTSW 12 108514508 missense probably damaging 1.00
R6491:Eml1 UTSW 12 108513071 critical splice donor site probably null
R7035:Eml1 UTSW 12 108509234 missense probably damaging 1.00
R7134:Eml1 UTSW 12 108506551 missense not run
Z1088:Eml1 UTSW 12 108537459 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGTGTGCCCTACAAGCTAAC -3'
(R):5'- GGAAGACAGTGGGTACGCATTC -3'

Sequencing Primer
(F):5'- CCTACAAGCTAACCAGACTGTG -3'
(R):5'- TGGGTACGCATTCGAACG -3'
Posted On2016-07-22