Incidental Mutation 'R5208:Asic4'
ID402119
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5208 (G1)
Quality Score205
Status Not validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75451226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000109207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000113577]
Predicted Effect probably damaging
Transcript: ENSMUST00000037708
AA Change: D132G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: D132G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113577
AA Change: D132G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: D132G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
PIT4445001:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3614:Asic4 UTSW 1 75473058 missense probably damaging 1.00
R3790:Asic4 UTSW 1 75469841 unclassified probably benign
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6512:Asic4 UTSW 1 75473043 nonsense probably null
R6530:Asic4 UTSW 1 75472335 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGGAGGATGCAAAACCC -3'
(R):5'- CTCACCACAGAGAAGTTGCTGG -3'

Sequencing Primer
(F):5'- ATGAACAGAGCCTCCTGGG -3'
(R):5'- CAGAGAAGTTGCTGGCGGAG -3'
Posted On2016-07-22