Incidental Mutation 'R5208:Pex2'
ID402137
Institutional Source Beutler Lab
Gene Symbol Pex2
Ensembl Gene ENSMUSG00000040374
Gene Nameperoxisomal biogenesis factor 2
SynonymsD3Ertd138e, peroxisome biogenesis factor 2, Pex2, PMP35, Pxmp3, Zellweger syndrome homolog
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location5560188-5576239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5561368 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 127 (R127H)
Ref Sequence ENSEMBL: ENSMUSP00000141927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059021] [ENSMUST00000071280] [ENSMUST00000164828] [ENSMUST00000165309] [ENSMUST00000191916] [ENSMUST00000195855]
Predicted Effect probably benign
Transcript: ENSMUST00000059021
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059415
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071280
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071255
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164828
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129311
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165309
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126445
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 225 3.7e-39 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191916
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141945
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195855
AA Change: R127H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141927
Gene: ENSMUSG00000040374
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral peroxisomal membrane protein required for peroxisome biogenesis. The protein is thought to be involved in peroxisomal matrix protein import. Mutations in this gene result in one form of Zellweger syndrome and infantile Refsum disease. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die sometime before weaning. Various abnormalities are seen in the central nervous system depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Pex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Pex2 APN 3 5561364 missense probably benign 0.00
IGL03186:Pex2 APN 3 5561717 missense probably benign 0.04
R0194:Pex2 UTSW 3 5561364 missense probably benign 0.00
R0479:Pex2 UTSW 3 5561295 missense probably damaging 1.00
R2145:Pex2 UTSW 3 5561590 missense probably damaging 1.00
R2862:Pex2 UTSW 3 5561180 missense probably damaging 1.00
R3890:Pex2 UTSW 3 5560948 missense probably damaging 1.00
R3891:Pex2 UTSW 3 5560948 missense probably damaging 1.00
R4627:Pex2 UTSW 3 5561281 missense probably damaging 0.98
R5884:Pex2 UTSW 3 5561299 missense probably benign
R6474:Pex2 UTSW 3 5561131 missense probably damaging 1.00
R7158:Pex2 UTSW 3 5561336 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACTCAAAGCCAACTTCGCG -3'
(R):5'- TGAAAGCATTTCTGTGGCTTTTCC -3'

Sequencing Primer
(F):5'- AAGCCAACTTCGCGCATGTTC -3'
(R):5'- ATGGAGGTTCACCATCTACTCC -3'
Posted On2016-07-22