Incidental Mutation 'R5208:Arl4a'
ID402169
Institutional Source Beutler Lab
Gene Symbol Arl4a
Ensembl Gene ENSMUSG00000047446
Gene NameADP-ribosylation factor-like 4A
SynonymsArl4
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location40005447-40038025 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 40036745 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000122987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101472] [ENSMUST00000136441] [ENSMUST00000144910] [ENSMUST00000146905]
Predicted Effect probably null
Transcript: ENSMUST00000101472
AA Change: M1K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099013
Gene: ENSMUSG00000047446
AA Change: M1K

DomainStartEndE-ValueType
ARF 1 190 1.31e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135883
Predicted Effect probably null
Transcript: ENSMUST00000136441
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122987
Gene: ENSMUSG00000047446
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Arf 8 64 8.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144910
AA Change: M1K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122126
Gene: ENSMUSG00000047446
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Arf 8 64 8.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146905
AA Change: M1K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114458
Gene: ENSMUSG00000047446
AA Change: M1K

DomainStartEndE-ValueType
ARF 1 190 1.31e-50 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in small testes, reduced sperm count, and abnormal spermiogenesis. Both male and female homozygotes are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Arl4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02470:Arl4a APN 12 40036748 utr 5 prime probably benign
IGL02838:Arl4a APN 12 40036304 missense probably benign 0.00
R6155:Arl4a UTSW 12 40036520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAATTGCCCAAGGTTACC -3'
(R):5'- CTCATCTGGTGTGTTTACTCACAG -3'

Sequencing Primer
(F):5'- GCCCAAGGTTACCTTAATTTTCTCAG -3'
(R):5'- CTCACAGCAAGTTTTATTAAGTCCC -3'
Posted On2016-07-22