Incidental Mutation 'R5208:Ttc37'
ID402176
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76147767 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1050 (E1050K)
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091466
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: E1050K

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224289
Predicted Effect possibly damaging
Transcript: ENSMUST00000224386
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7384:Ttc37 UTSW 13 76150735 missense possibly damaging 0.53
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGCAGTCAGATCCTCTC -3'
(R):5'- TTTTAGTAAACACTGCAACCCC -3'

Sequencing Primer
(F):5'- GCAGTCAGATCCTCTCTATGTGTG -3'
(R):5'- CTAGAGGATCAAGGTTCAATTCCCAG -3'
Posted On2016-07-22