Incidental Mutation 'R5208:Lonp1'
ID402182
Institutional Source Beutler Lab
Gene Symbol Lonp1
Ensembl Gene ENSMUSG00000041168
Gene Namelon peptidase 1, mitochondrial
Synonyms1200017E13Rik, LON, Prss15
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56614301-56626903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56617793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 538 (V538A)
Ref Sequence ENSEMBL: ENSMUSP00000041814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000080492]
Predicted Effect probably damaging
Transcript: ENSMUST00000047226
AA Change: V538A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: V538A

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080492
SMART Domains Protein: ENSMUSP00000079340
Gene: ENSMUSG00000057863

DomainStartEndE-ValueType
Pfam:Ribosomal_L36e 2 100 2.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Gulp1 T G 1: 44,781,039 H235Q probably benign Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Lonp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lonp1 APN 17 56619265 missense probably damaging 1.00
IGL00934:Lonp1 APN 17 56614683 missense probably benign 0.21
IGL01065:Lonp1 APN 17 56615500 unclassified probably benign
IGL01343:Lonp1 APN 17 56615586 missense possibly damaging 0.93
IGL01734:Lonp1 APN 17 56616026 missense probably damaging 1.00
IGL02141:Lonp1 APN 17 56615086 missense probably benign 0.19
IGL02979:Lonp1 APN 17 56621940 missense probably benign 0.02
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0863:Lonp1 UTSW 17 56618331 missense probably damaging 1.00
R1343:Lonp1 UTSW 17 56620272 missense probably damaging 1.00
R1735:Lonp1 UTSW 17 56614956 missense probably damaging 1.00
R1975:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1976:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1977:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R2484:Lonp1 UTSW 17 56614659 missense probably damaging 1.00
R2895:Lonp1 UTSW 17 56615562 missense probably damaging 1.00
R3123:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3125:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3429:Lonp1 UTSW 17 56618337 missense probably damaging 1.00
R3726:Lonp1 UTSW 17 56618310 unclassified probably benign
R3767:Lonp1 UTSW 17 56621952 missense possibly damaging 0.80
R4618:Lonp1 UTSW 17 56622511 missense probably benign 0.03
R4859:Lonp1 UTSW 17 56626587 missense probably benign 0.00
R4951:Lonp1 UTSW 17 56620335 missense possibly damaging 0.64
R5620:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5621:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5622:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R6131:Lonp1 UTSW 17 56614457 missense probably benign 0.01
R6377:Lonp1 UTSW 17 56621961 missense possibly damaging 0.90
R6692:Lonp1 UTSW 17 56619230 missense probably damaging 1.00
R7052:Lonp1 UTSW 17 56626549 missense probably benign 0.31
R7131:Lonp1 UTSW 17 56617814 missense probably damaging 1.00
R7295:Lonp1 UTSW 17 56622495 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACAACTAGTGTACCTCCTTGTC -3'
(R):5'- TGCTGGATGATAGCCCCTTG -3'

Sequencing Primer
(F):5'- TTGTCCCACCCAACCACATGG -3'
(R):5'- GATGATAGCCCCTTGGTCTTTGC -3'
Posted On2016-07-22