Incidental Mutation 'R5221:Col4a2'
ID402322
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 042794-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5221 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11448225 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1678 (N1678S)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably benign
Transcript: ENSMUST00000033899
AA Change: N1678S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: N1678S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146219
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap26 T A 18: 39,110,472 Y134* probably null Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
BC037034 C T 5: 138,262,240 S308N probably benign Het
Bean1 A T 8: 104,215,152 D34V probably damaging Het
C8a C T 4: 104,845,925 V312M probably damaging Het
Ccser1 T C 6: 61,312,091 S413P probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Dsg1a T A 18: 20,324,014 M148K possibly damaging Het
Fam173a T C 17: 25,791,639 N67S possibly damaging Het
Farp2 T A 1: 93,576,418 C306S probably damaging Het
Frem2 A G 3: 53,585,611 V1828A probably damaging Het
Gm6457 T C 18: 14,570,117 noncoding transcript Het
Gm8979 G C 7: 106,083,974 noncoding transcript Het
Gm9268 T A 7: 43,023,260 H106Q probably benign Het
Gm9774 T C 3: 92,428,508 I296V probably benign Het
Gmip T G 8: 69,814,135 V300G probably damaging Het
Gstp3 A G 19: 4,057,607 S186P probably damaging Het
Kl G T 5: 150,989,151 L788F probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrp1b A C 2: 41,112,982 S1932A possibly damaging Het
Lrrc36 A G 8: 105,443,856 T234A probably damaging Het
Mafa T A 15: 75,747,042 Q294L possibly damaging Het
Mesp2 C T 7: 79,811,719 T264I possibly damaging Het
Mindy4 A G 6: 55,224,107 Y259C probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1026 A G 2: 85,924,149 N294D probably damaging Het
Olfr1111 T C 2: 87,150,481 Y60C probably damaging Het
Olfr709-ps1 A T 7: 106,927,061 S133T probably benign Het
Olfr912 A T 9: 38,581,852 T192S probably damaging Het
Pcm1 T C 8: 41,288,156 probably null Het
Plxna1 T C 6: 89,321,016 D1760G probably damaging Het
Polq T A 16: 37,042,178 D345E probably damaging Het
Ppp1r14a T A 7: 29,289,501 I56N probably damaging Het
Ppp1r1a G A 15: 103,533,050 P79S probably damaging Het
Ptprf C T 4: 118,225,108 R1010H probably benign Het
Rai1 A G 11: 60,190,597 E1829G probably damaging Het
Rmdn3 A G 2: 119,156,454 Y31H probably damaging Het
Rrh T C 3: 129,815,631 S69G probably damaging Het
Skint6 A T 4: 112,894,924 probably null Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Sltm T G 9: 70,579,403 L450R probably damaging Het
Sufu T C 19: 46,450,965 probably null Het
Tmem68 T C 4: 3,560,561 T208A possibly damaging Het
Tnc T A 4: 63,993,297 R1346* probably null Het
Tpbg T C 9: 85,844,425 L149P probably damaging Het
Ubtf G A 11: 102,307,990 Q585* probably null Het
Vmn2r68 A T 7: 85,221,877 C733S probably damaging Het
Wscd1 G T 11: 71,768,675 G194W possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp462 T A 4: 55,016,887 V870E possibly damaging Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATGTGACCTCTAACAC -3'
(R):5'- TTTGGGATCAGCATCTGAGG -3'

Sequencing Primer
(F):5'- TGTGACCTCTAACACACTTCATC -3'
(R):5'- TTACATAGTTCCAGGCTAGGCAG -3'
Posted On2016-07-22