Incidental Mutation 'R5222:Tcf7l2'
ID402396
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Nametranscription factor 7 like 2, T cell specific, HMG box
SynonymsTCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
MMRRC Submission 042795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5222 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55741810-55933654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55898612 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 19 (Q19R)
Ref Sequence ENSEMBL: ENSMUSP00000119759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111646] [ENSMUST00000111649] [ENSMUST00000111651] [ENSMUST00000111652] [ENSMUST00000111653] [ENSMUST00000111654] [ENSMUST00000111656] [ENSMUST00000111657] [ENSMUST00000111658] [ENSMUST00000111659] [ENSMUST00000111662] [ENSMUST00000142291] [ENSMUST00000148666] [ENSMUST00000153888]
Predicted Effect probably benign
Transcript: ENSMUST00000041717
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061496
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111646
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111649
SMART Domains Protein: ENSMUSP00000107276
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111651
SMART Domains Protein: ENSMUSP00000107278
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 284 2.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111652
SMART Domains Protein: ENSMUSP00000107279
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 9.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111653
SMART Domains Protein: ENSMUSP00000107280
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111654
SMART Domains Protein: ENSMUSP00000107281
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.2e-93 PFAM
HMG 345 415 1.16e-22 SMART
low complexity region 421 429 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111656
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111657
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111658
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111659
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111662
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126434
Predicted Effect probably benign
Transcript: ENSMUST00000127233
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133008
Predicted Effect probably benign
Transcript: ENSMUST00000142291
SMART Domains Protein: ENSMUSP00000118042
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 5e-40 PFAM
SCOP:d1j46a_ 164 178 5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145249
Predicted Effect probably benign
Transcript: ENSMUST00000148666
AA Change: Q19R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119759
Gene: ENSMUSG00000024985
AA Change: Q19R

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 10 106 5.7e-39 PFAM
HMG 196 265 1.02e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153888
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Meta Mutation Damage Score 0.1632 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik C A 1: 160,044,608 noncoding transcript Het
Acad11 G A 9: 104,097,377 A515T probably damaging Het
Angpt1 T C 15: 42,676,334 Y43C probably damaging Het
Arhgef33 A G 17: 80,337,314 Y24C probably damaging Het
Cd40 G C 2: 165,066,544 S180T probably benign Het
Cenpc1 A T 5: 86,037,747 S302T possibly damaging Het
Cit C A 5: 115,952,543 T932K probably benign Het
Col19a1 A C 1: 24,559,640 probably null Het
Dapk3 A G 10: 81,192,460 E288G probably damaging Het
Ddx60 T C 8: 61,984,158 F1002S probably damaging Het
Dgke G T 11: 89,050,394 T321K probably benign Het
Ebf2 T G 14: 67,313,594 probably benign Het
Enpp7 A G 11: 118,990,962 D311G probably benign Het
Epm2a A G 10: 11,448,749 E194G probably damaging Het
Esf1 A G 2: 140,158,583 Y428H possibly damaging Het
Esyt2 T C 12: 116,318,826 F132S probably damaging Het
Gm13101 T A 4: 143,964,792 I454F possibly damaging Het
Gm5455 T C 13: 110,304,960 noncoding transcript Het
Gria1 T A 11: 57,189,797 V202E probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mark1 A T 1: 184,928,091 F123I probably damaging Het
Nectin4 T A 1: 171,385,257 probably null Het
Obscn T A 11: 59,044,145 T5220S possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1370 T A 13: 21,072,569 H244L probably damaging Het
Olfr166 A C 16: 19,486,930 I31L probably benign Het
Pdcd1 A T 1: 94,052,450 V14E probably damaging Het
Pmel A G 10: 128,718,984 probably null Het
Prrx1 C T 1: 163,261,973 R95Q probably damaging Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Ptprq A G 10: 107,662,564 I884T probably damaging Het
Rad17 G A 13: 100,633,891 T216I possibly damaging Het
Rif1 T C 2: 52,077,020 I107T probably benign Het
Rpp14 T C 14: 8,087,513 L69P probably damaging Het
Rtel1 G T 2: 181,346,983 probably benign Het
Sap130 C T 18: 31,666,703 T362M probably damaging Het
Scn11a A G 9: 119,815,202 probably null Het
Sec31a G T 5: 100,382,895 T243N probably benign Het
Slc5a9 T A 4: 111,898,611 H30L possibly damaging Het
Slco6b1 T A 1: 96,997,491 noncoding transcript Het
Smarca4 A G 9: 21,655,706 D694G probably benign Het
Spaca6 A G 17: 17,838,105 T213A probably benign Het
Tagap C A 17: 7,933,641 Q553K possibly damaging Het
Tagap A T 17: 7,933,642 Q553L possibly damaging Het
Ttn A G 2: 76,878,853 probably benign Het
Ubr7 A T 12: 102,775,705 R399S probably benign Het
Uspl1 C A 5: 149,214,101 Q690K possibly damaging Het
Vps8 T A 16: 21,581,548 Y853* probably null Het
Vrk3 A T 7: 44,759,796 Q129L possibly damaging Het
Wapl T A 14: 34,736,685 C901* probably null Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
banned UTSW 19 55931432 critical splice acceptor site probably null
PIT4468001:Tcf7l2 UTSW 19 55742388 missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55918955 missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55743195 missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55931454 missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55894733 critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55926740 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCCATCTTGAAGGTACAGAG -3'
(R):5'- CTGCACTGACCATTCATTCTGG -3'

Sequencing Primer
(F):5'- GCTATTATGTACCCCAGGGA -3'
(R):5'- GCACTGACCATTCATTCTGGTTTTG -3'
Posted On2016-07-22