Incidental Mutation 'R5223:Pacs1'
ID402471
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Namephosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission 042796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5223 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5133688-5273119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5145141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 472 (V472I)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
Predicted Effect probably benign
Transcript: ENSMUST00000025786
AA Change: V472I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: V472I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,013,452 V273M possibly damaging Het
Acin1 CCGC CC 14: 54,642,941 probably null Het
Acvr1b T A 15: 101,193,976 C46S probably damaging Het
Ahi1 A T 10: 20,970,919 H416L possibly damaging Het
Aspm T A 1: 139,478,334 L1653Q probably damaging Het
Cacna1a G A 8: 84,587,195 V1533M possibly damaging Het
Ccdc33 C T 9: 58,032,984 E502K possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Cyp2a12 A T 7: 27,036,463 probably null Het
Ep400 A G 5: 110,668,630 V2675A probably damaging Het
Foxh1 T A 15: 76,668,729 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10093 A G 17: 78,492,438 E286G probably benign Het
Gm13078 T A 4: 143,728,021 S296R probably benign Het
Gpnmb C T 6: 49,056,205 T539M probably benign Het
Hspa9 A G 18: 34,952,671 probably null Het
Hspg2 T C 4: 137,543,914 L2454P probably damaging Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Igkv6-32 T C 6: 70,074,223 S50G probably benign Het
Il23r T A 6: 67,486,170 Y113F probably benign Het
Kcnt1 A G 2: 25,903,422 D636G probably benign Het
Klhl41 G A 2: 69,679,827 W569* probably null Het
Klra4 T A 6: 130,062,147 D94V probably damaging Het
Lca5 T A 9: 83,398,613 H378L probably benign Het
Lhx8 T A 3: 154,321,644 T254S probably damaging Het
Lrch3 C T 16: 32,914,397 R86W probably damaging Het
Lrp2 T A 2: 69,524,053 N477I probably damaging Het
Man2a1 T A 17: 64,712,271 I710K probably benign Het
Ncor1 A T 11: 62,339,000 Y881N probably damaging Het
Nhsl1 T A 10: 18,526,326 V1100E probably damaging Het
Olfr1208 T C 2: 88,897,334 T88A probably benign Het
Olfr486 A G 7: 108,172,708 V12A probably benign Het
Olfr855 T C 9: 19,585,026 V163A probably benign Het
Oprk1 T C 1: 5,589,296 V83A probably benign Het
Pard3b T C 1: 62,344,113 Y789H probably damaging Het
Pcdha2 T C 18: 36,940,791 Y492H probably damaging Het
Pcnt T C 10: 76,380,272 N2261D probably damaging Het
Pex5l A T 3: 32,958,796 S15T probably damaging Het
Plekhg4 A G 8: 105,378,949 N682S probably benign Het
Poc5 A T 13: 96,402,955 M335L probably benign Het
Polr1a C T 6: 71,967,907 R1316W possibly damaging Het
Pp2d1 T C 17: 53,507,845 H617R probably benign Het
Prpsap1 T C 11: 116,488,148 K65E probably benign Het
Ptgfrn T C 3: 101,045,593 E775G probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbbp8 C A 18: 11,721,690 A324E probably benign Het
Rfx6 G T 10: 51,677,996 G63* probably null Het
Rpl37a T C 1: 72,712,149 M47T probably benign Het
Samm50 T G 15: 84,200,630 N187K probably benign Het
Skiv2l A G 17: 34,845,166 probably null Het
Slamf9 T C 1: 172,476,232 I48T possibly damaging Het
Slc2a12 A G 10: 22,702,032 K576E probably damaging Het
Slc4a10 G A 2: 62,253,366 G388S probably damaging Het
Smtn G T 11: 3,529,530 N512K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sspo A G 6: 48,478,324 Y3040C probably damaging Het
Stat1 T A 1: 52,144,242 V389E probably damaging Het
Sult5a1 A T 8: 123,145,422 M227K probably damaging Het
Thsd4 T C 9: 60,057,042 D389G probably damaging Het
Tnxb T C 17: 34,704,078 V2545A possibly damaging Het
Tpo T A 12: 30,092,590 I712F probably damaging Het
Trim62 T C 4: 128,909,411 V418A probably damaging Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r66 T C 7: 85,007,885 D104G probably benign Het
Wdr26 T C 1: 181,187,686 I371V probably benign Het
Wdr78 T A 4: 103,049,403 S738C possibly damaging Het
Zfp273 T G 13: 67,826,179 C475W probably damaging Het
Zfp738 G T 13: 67,673,063 T55K probably damaging Het
Zmym2 A G 14: 56,946,514 I978V probably benign Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAATAGCCATTTCAACCC -3'
(R):5'- TAGGCAAAGCTCTGACGCAG -3'

Sequencing Primer
(F):5'- GGTCAATAGCCATTTCAACCCCAAAG -3'
(R):5'- ATGGGAGCACATGGCATCCAG -3'
Posted On2016-07-22