Incidental Mutation 'R5224:Tnr'
ID402473
Institutional Source Beutler Lab
Gene Symbol Tnr
Ensembl Gene ENSMUSG00000015829
Gene Nametenascin R
SynonymsTN-R, janusin, restrictin, J1-tenascin
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location159523769-159931729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 159923315 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1282 (D1282G)
Ref Sequence ENSEMBL: ENSMUSP00000141553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]
Predicted Effect probably damaging
Transcript: ENSMUST00000111669
AA Change: D1282G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: D1282G

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192069
AA Change: D1282G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: D1282G

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Tnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tnr APN 1 159861245 missense probably benign 0.00
IGL00905:Tnr APN 1 159852182 missense probably benign 0.06
IGL01396:Tnr APN 1 159897024 missense possibly damaging 0.91
IGL01550:Tnr APN 1 159874258 missense probably benign
IGL01803:Tnr APN 1 159868243 missense probably damaging 1.00
IGL01845:Tnr APN 1 159868006 unclassified probably benign
IGL01983:Tnr APN 1 159863779 missense probably benign 0.00
IGL01985:Tnr APN 1 159919037 missense possibly damaging 0.70
IGL02210:Tnr APN 1 159852101 missense probably benign 0.44
IGL02486:Tnr APN 1 159852094 unclassified probably null
IGL03210:Tnr APN 1 159888310 missense probably benign 0.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0009:Tnr UTSW 1 159852416 missense probably damaging 1.00
R0042:Tnr UTSW 1 159887025 missense probably benign 0.01
R0594:Tnr UTSW 1 159850335 missense probably benign
R0617:Tnr UTSW 1 159868103 missense probably damaging 1.00
R0637:Tnr UTSW 1 159850335 missense possibly damaging 0.60
R0682:Tnr UTSW 1 159852307 nonsense probably null
R1171:Tnr UTSW 1 159858210 missense probably damaging 0.97
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1335:Tnr UTSW 1 159868030 missense probably benign 0.18
R1540:Tnr UTSW 1 159850105 missense probably damaging 0.99
R1697:Tnr UTSW 1 159852030 missense probably benign 0.00
R1938:Tnr UTSW 1 159895037 nonsense probably null
R1941:Tnr UTSW 1 159850134 missense possibly damaging 0.92
R2021:Tnr UTSW 1 159852022 missense probably benign
R2022:Tnr UTSW 1 159852022 missense probably benign
R2051:Tnr UTSW 1 159892033 missense probably benign
R2157:Tnr UTSW 1 159858270 missense probably damaging 0.98
R2319:Tnr UTSW 1 159850048 start codon destroyed probably null 1.00
R2936:Tnr UTSW 1 159888362 missense probably damaging 0.96
R3015:Tnr UTSW 1 159888259 missense probably benign 0.00
R3417:Tnr UTSW 1 159895042 missense probably benign 0.00
R3739:Tnr UTSW 1 159923413 missense possibly damaging 0.78
R3977:Tnr UTSW 1 159892023 missense probably benign
R4232:Tnr UTSW 1 159886215 missense possibly damaging 0.55
R4478:Tnr UTSW 1 159884756 splice site probably null
R4774:Tnr UTSW 1 159897066 missense probably damaging 1.00
R4829:Tnr UTSW 1 159858404 missense probably benign 0.24
R4837:Tnr UTSW 1 159684788 intron probably benign
R5111:Tnr UTSW 1 159886228 missense probably benign 0.04
R5249:Tnr UTSW 1 159684656 intron probably benign
R5730:Tnr UTSW 1 159888322 missense probably benign 0.02
R5807:Tnr UTSW 1 159886930 missense possibly damaging 0.95
R5832:Tnr UTSW 1 159886122 missense probably benign 0.15
R5927:Tnr UTSW 1 159912766 missense probably damaging 1.00
R6049:Tnr UTSW 1 159912754 missense probably damaging 1.00
R6056:Tnr UTSW 1 159886909 missense probably damaging 0.99
R6063:Tnr UTSW 1 159912684 missense probably benign 0.00
R6141:Tnr UTSW 1 159887122 missense probably benign
R6218:Tnr UTSW 1 159888314 missense possibly damaging 0.94
R6275:Tnr UTSW 1 159861270 missense probably damaging 0.99
R6543:Tnr UTSW 1 159924107 missense probably damaging 1.00
R6626:Tnr UTSW 1 159850252 missense probably damaging 1.00
X0011:Tnr UTSW 1 159889338 missense probably benign 0.02
X0028:Tnr UTSW 1 159874114 missense probably damaging 1.00
Z1088:Tnr UTSW 1 159895095 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATAGCCATGACGCAGCTCAG -3'
(R):5'- GGTCTTTTCTCAGTCCCAGAG -3'

Sequencing Primer
(F):5'- CATGACGCAGCTCAGAAGGAAAAG -3'
(R):5'- CCCAGAGTACTTCTTTTTAAAGAGG -3'
Posted On2016-07-22