Incidental Mutation 'R5224:Btbd11'
List |< first << previous [record 63 of 585] next >> last >|
ID402509
Institutional Source Beutler Lab
Gene Symbol Btbd11
Ensembl Gene ENSMUSG00000020042
Gene NameBTB (POZ) domain containing 11
Synonyms6330404E16Rik
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5224 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location85386814-85660292 bp(+) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CGTGACCTTTCTGGT to CGT at 85645522 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020231] [ENSMUST00000105306] [ENSMUST00000105307]
Predicted Effect probably benign
Transcript: ENSMUST00000020231
SMART Domains Protein: ENSMUSP00000020231
Gene: ENSMUSG00000020042

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
Blast:H2B 122 173 3e-9 BLAST
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 6e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 9e-16 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105306
SMART Domains Protein: ENSMUSP00000100943
Gene: ENSMUSG00000020042

DomainStartEndE-ValueType
ANK 139 168 2.74e-7 SMART
ANK 185 214 7.3e-3 SMART
ANK 223 252 1.05e-3 SMART
ANK 266 296 2.21e3 SMART
BTB 459 558 5.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105307
SMART Domains Protein: ENSMUSP00000100944
Gene: ENSMUSG00000020042

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 5e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 1e-15 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
ANK 692 721 1.05e-3 SMART
ANK 735 765 2.21e3 SMART
BTB 928 1027 5.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156123
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Rhag T C 17: 40,828,504 L110P probably damaging Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Btbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Btbd11 APN 10 85629216 missense possibly damaging 0.87
IGL01143:Btbd11 APN 10 85654471 splice site probably benign
IGL01365:Btbd11 APN 10 85633816 missense possibly damaging 0.75
IGL01409:Btbd11 APN 10 85658165 missense possibly damaging 0.88
IGL01531:Btbd11 APN 10 85629205 splice site probably benign
IGL01593:Btbd11 APN 10 85654475 splice site probably benign
IGL01751:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL01752:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL02041:Btbd11 APN 10 85387554 missense unknown
IGL02486:Btbd11 APN 10 85640555 missense probably damaging 1.00
IGL02597:Btbd11 APN 10 85633801 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85633837 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85631286
IGL02967:Btbd11 APN 10 85633782 missense probably benign 0.11
IGL02975:Btbd11 APN 10 85631343 missense probably benign 0.16
IGL03078:Btbd11 APN 10 85632163 missense probably damaging 1.00
IGL03130:Btbd11 APN 10 85388483 splice site probably null
IGL03335:Btbd11 APN 10 85658358 utr 3 prime probably benign
R0024:Btbd11 UTSW 10 85387447 missense unknown
R0599:Btbd11 UTSW 10 85658336 missense probably damaging 1.00
R0655:Btbd11 UTSW 10 85645526 missense probably damaging 1.00
R0660:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R0664:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R1155:Btbd11 UTSW 10 85629291 missense probably damaging 1.00
R1244:Btbd11 UTSW 10 85387363 missense unknown
R1389:Btbd11 UTSW 10 85640596 missense possibly damaging 0.76
R1418:Btbd11 UTSW 10 85645578 missense probably damaging 1.00
R1703:Btbd11 UTSW 10 85387384 missense unknown
R1957:Btbd11 UTSW 10 85633699 missense probably damaging 1.00
R2519:Btbd11 UTSW 10 85651611 missense probably damaging 1.00
R3716:Btbd11 UTSW 10 85561528 missense probably damaging 1.00
R3915:Btbd11 UTSW 10 85632270 missense probably damaging 1.00
R4738:Btbd11 UTSW 10 85627248 nonsense probably null
R4782:Btbd11 UTSW 10 85654550 missense probably damaging 1.00
R4846:Btbd11 UTSW 10 85629266 missense probably damaging 1.00
R4887:Btbd11 UTSW 10 85387378 missense unknown
R4960:Btbd11 UTSW 10 85651662 missense probably benign 0.34
R5341:Btbd11 UTSW 10 85387372 missense unknown
R5713:Btbd11 UTSW 10 85651652 missense probably damaging 1.00
R6046:Btbd11 UTSW 10 85388083 missense unknown
R6461:Btbd11 UTSW 10 85640564 missense probably damaging 1.00
R6809:Btbd11 UTSW 10 85631376 missense probably benign 0.01
X0020:Btbd11 UTSW 10 85631352 missense possibly damaging 0.86
Z1088:Btbd11 UTSW 10 85387857 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTGTGATGAGCCATAATAATGCATC -3'
(R):5'- TCTGCTAGCCCAGTGACAAC -3'

Sequencing Primer
(F):5'- AATAATGCATCTGTCCTCCATGGG -3'
(R):5'- ATGAGGCCTTGGCTACAATC -3'
Posted On2016-07-22