Incidental Mutation 'R5225:Olfr1264'
ID402536
Institutional Source Beutler Lab
Gene Symbol Olfr1264
Ensembl Gene ENSMUSG00000075069
Gene Nameolfactory receptor 1264
SynonymsGA_x6K02T2Q125-51454183-51453257, MOR236-1
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90018526-90025577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90021184 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 294 (D294A)
Ref Sequence ENSEMBL: ENSMUSP00000149126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099758] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably benign
Transcript: ENSMUST00000099758
AA Change: D294A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097347
Gene: ENSMUSG00000075069
AA Change: D294A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.8e-47 PFAM
Pfam:7tm_1 39 285 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
Predicted Effect probably benign
Transcript: ENSMUST00000216616
AA Change: D294A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably benign
Transcript: ENSMUST00000217065
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Olfr1264
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1635:Olfr1264 UTSW 2 90021970 missense possibly damaging 0.94
R1758:Olfr1264 UTSW 2 90021329 missense probably benign
R1930:Olfr1264 UTSW 2 90021161 missense probably benign
R2159:Olfr1264 UTSW 2 90021538 missense probably damaging 0.97
R3977:Olfr1264 UTSW 2 90021745 missense probably damaging 1.00
R4028:Olfr1264 UTSW 2 90021223 missense probably damaging 1.00
R4884:Olfr1264 UTSW 2 90021643 missense probably benign 0.19
R5194:Olfr1264 UTSW 2 90021526 missense probably damaging 1.00
R5399:Olfr1264 UTSW 2 90021923 missense probably benign 0.19
R5436:Olfr1264 UTSW 2 90021665 missense probably benign 0.25
R5753:Olfr1264 UTSW 2 90021503 missense possibly damaging 0.87
R6225:Olfr1264 UTSW 2 90021229 unclassified probably null
R6391:Olfr1264 UTSW 2 90021631 missense probably benign 0.03
R6531:Olfr1264 UTSW 2 90021457 missense probably benign 0.03
R7293:Olfr1264 UTSW 2 90021527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCTAGTCTATAATAAAACAGTGC -3'
(R):5'- GGAAAGCTCTGTCTACCTGTGG -3'

Sequencing Primer
(F):5'- CAGTGCAACTTAAGTAAAAACACAG -3'
(R):5'- GGGCTCACTTCACTGTGGTTAC -3'
Posted On2016-07-22