Incidental Mutation 'R5225:Tln1'
ID402542
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43539406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1639 (T1639A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: T1639A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: T1639A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGCTGTCTCACACTCCAG -3'
(R):5'- CTTCGTGAGCATAAGTCATGAGAC -3'

Sequencing Primer
(F):5'- TTGTCCCTGCAGAGACATCAC -3'
(R):5'- TCATGAGACTCGCCTCCG -3'
Posted On2016-07-22