Incidental Mutation 'R5225:Sdc3'
ID402543
Institutional Source Beutler Lab
Gene Symbol Sdc3
Ensembl Gene ENSMUSG00000025743
Gene Namesyndecan 3
SynonymsSynd3, syn-3
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130792537-130826319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130818776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 55 (V55I)
Ref Sequence ENSEMBL: ENSMUSP00000118685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070478] [ENSMUST00000141297] [ENSMUST00000152591]
Predicted Effect unknown
Transcript: ENSMUST00000070478
AA Change: V149I
SMART Domains Protein: ENSMUSP00000065877
Gene: ENSMUSG00000025743
AA Change: V149I

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
low complexity region 60 76 N/A INTRINSIC
low complexity region 101 115 N/A INTRINSIC
low complexity region 123 154 N/A INTRINSIC
low complexity region 157 202 N/A INTRINSIC
low complexity region 213 240 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
4.1m 408 426 2.51e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140623
Predicted Effect unknown
Transcript: ENSMUST00000141297
AA Change: V55I
SMART Domains Protein: ENSMUSP00000123608
Gene: ENSMUSG00000025743
AA Change: V55I

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 29 60 N/A INTRINSIC
low complexity region 63 108 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146093
Predicted Effect unknown
Transcript: ENSMUST00000152591
AA Change: V55I
SMART Domains Protein: ENSMUSP00000118685
Gene: ENSMUSG00000025743
AA Change: V55I

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 29 60 N/A INTRINSIC
low complexity region 63 108 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the syndecan proteoglycan family. It may play a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced long-term potentiation and impaired hippocampus-dependent memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Sdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sdc3 APN 4 130818680 missense unknown
IGL01715:Sdc3 APN 4 130819067 missense probably damaging 0.99
IGL02160:Sdc3 APN 4 130818575 splice site probably benign
IGL03134:Sdc3 UTSW 4 130821504 missense probably benign 0.00
R2426:Sdc3 UTSW 4 130818803 missense unknown
R4678:Sdc3 UTSW 4 130818596 utr 5 prime probably benign
R4779:Sdc3 UTSW 4 130819065 missense probably damaging 0.99
R4786:Sdc3 UTSW 4 130822768 missense probably damaging 0.97
R5182:Sdc3 UTSW 4 130821684 unclassified probably benign
R6111:Sdc3 UTSW 4 130818842 missense unknown
R6980:Sdc3 UTSW 4 130816922 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGGATTTTGGCTAGGCACGG -3'
(R):5'- TGTATGCCGGTGGTCCTTAC -3'

Sequencing Primer
(F):5'- TCCTGCTGGGAAGGCAATG -3'
(R):5'- GTGGTCCTTACGTCAGCCAC -3'
Posted On2016-07-22