Incidental Mutation 'R5225:Mmel1'
ID402544
Institutional Source Beutler Lab
Gene Symbol Mmel1
Ensembl Gene ENSMUSG00000058183
Gene Namemembrane metallo-endopeptidase-like 1
SynonymsNep2, Mell1, Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154869585-154895528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154891999 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 520 (N520S)
Ref Sequence ENSEMBL: ENSMUSP00000101259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030935] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000163732]
Predicted Effect probably benign
Transcript: ENSMUST00000030935
SMART Domains Protein: ENSMUSP00000030935
Gene: ENSMUSG00000029059

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 53 166 9.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079269
AA Change: N506S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183
AA Change: N506S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080559
AA Change: N520S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183
AA Change: N520S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105634
AA Change: N520S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183
AA Change: N520S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105635
AA Change: N483S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183
AA Change: N483S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129623
Predicted Effect possibly damaging
Transcript: ENSMUST00000163732
AA Change: N506S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183
AA Change: N506S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Mmel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Mmel1 APN 4 154887832 splice site probably benign
IGL01560:Mmel1 APN 4 154892510 missense probably null 1.00
IGL01734:Mmel1 APN 4 154891951 missense probably benign 0.00
IGL02933:Mmel1 APN 4 154883630 missense probably damaging 1.00
IGL03178:Mmel1 APN 4 154890854 missense possibly damaging 0.75
R1161:Mmel1 UTSW 4 154895214 missense probably damaging 1.00
R1522:Mmel1 UTSW 4 154894986 missense probably damaging 1.00
R1566:Mmel1 UTSW 4 154883653 missense probably damaging 1.00
R1885:Mmel1 UTSW 4 154890876 missense possibly damaging 0.76
R2177:Mmel1 UTSW 4 154894103 missense probably damaging 1.00
R3413:Mmel1 UTSW 4 154889586 missense probably damaging 1.00
R3432:Mmel1 UTSW 4 154885498 splice site probably benign
R3870:Mmel1 UTSW 4 154883638 missense probably benign 0.01
R4197:Mmel1 UTSW 4 154893304 missense probably damaging 1.00
R4822:Mmel1 UTSW 4 154887897 missense probably benign 0.00
R4998:Mmel1 UTSW 4 154885510 missense probably benign 0.00
R5135:Mmel1 UTSW 4 154882324 missense probably benign 0.20
R5821:Mmel1 UTSW 4 154885587 missense possibly damaging 0.82
R6131:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6132:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6133:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6194:Mmel1 UTSW 4 154883216 nonsense probably null
R6223:Mmel1 UTSW 4 154871702 unclassified probably null
R6786:Mmel1 UTSW 4 154892428 nonsense probably null
R6921:Mmel1 UTSW 4 154881677 missense probably damaging 0.97
R7272:Mmel1 UTSW 4 154894090 missense probably damaging 1.00
X0025:Mmel1 UTSW 4 154894685 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGCCTGGTTCTGCAAGCTG -3'
(R):5'- AGACTCAAAGGTCAGCTGGG -3'

Sequencing Primer
(F):5'- AAGCTGGTGGAGGGAACTTGTC -3'
(R):5'- AGTTTCCCCATCTGTGAACAGGG -3'
Posted On2016-07-22