Incidental Mutation 'R5225:Pcbp1'
ID402549
Institutional Source Beutler Lab
Gene Symbol Pcbp1
Ensembl Gene ENSMUSG00000051695
Gene Namepoly(rC) binding protein 1
SynonymshnRNP E1, WBP17, [a]CP-1
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86524492-86526321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86525227 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 230 (I230N)
Ref Sequence ENSEMBL: ENSMUSP00000054863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053015]
Predicted Effect probably damaging
Transcript: ENSMUST00000053015
AA Change: I230N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054863
Gene: ENSMUSG00000051695
AA Change: I230N

DomainStartEndE-ValueType
KH 12 80 3.99e-16 SMART
KH 96 167 2.39e-14 SMART
KH 278 348 1.34e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205028
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced body weight. Mice homozygous for the allele exhibit embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Pcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Pcbp1 APN 6 86525854 missense probably damaging 0.96
R2968:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R3148:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R4522:Pcbp1 UTSW 6 86525050 missense probably benign 0.01
R5119:Pcbp1 UTSW 6 86524915 missense probably damaging 1.00
R5386:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R5698:Pcbp1 UTSW 6 86525152 missense possibly damaging 0.93
R7135:Pcbp1 UTSW 6 86525506 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCAGCCGATTAAGTTATTTGG -3'
(R):5'- CACCGAGTGTGTGAAGCAGATC -3'

Sequencing Primer
(F):5'- CAGCCGATTAAGTTATTTGGAATGG -3'
(R):5'- CAGATCTGCCTGGTCATGCTG -3'
Posted On2016-07-22