Incidental Mutation 'R5225:Cyp1a2'
ID402566
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 2
SynonymsCP12, aromatic compound inducible, P450-3
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57676937-57683703 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57677233 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 513 (K513*)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
Predicted Effect probably null
Transcript: ENSMUST00000034860
AA Change: K513*
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: K513*

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215792
Meta Mutation Damage Score 0.6624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57682069 nonsense probably null
IGL01161:Cyp1a2 APN 9 57679893 missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57682372 missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57682202 missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57682395 missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57677228 makesense probably null
IGL03349:Cyp1a2 APN 9 57679875 missense possibly damaging 0.82
PIT4515001:Cyp1a2 UTSW 9 57681959 missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57682061 missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57682025 missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57680246 splice site probably benign
R0589:Cyp1a2 UTSW 9 57679062 missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57681767 missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57682286 missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57682150 missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57677515 missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57679949 missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57681868 missense probably benign
R5419:Cyp1a2 UTSW 9 57682511 missense probably benign 0.17
R5471:Cyp1a2 UTSW 9 57679020 missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57681053 missense probably benign
R6017:Cyp1a2 UTSW 9 57681030 missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57677260 missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57682156 missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57677242 missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57681878 missense probably benign
R7081:Cyp1a2 UTSW 9 57678989 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AAGGCCTATGAACCTGCACG -3'
(R):5'- ATGCTCTTCGGCTTGGGAAAG -3'

Sequencing Primer
(F):5'- CTGTGTTAACTGAAAAGAGCCAGTC -3'
(R):5'- AAAGCGCCGGTGCATTG -3'
Posted On2016-07-22