Incidental Mutation 'R5225:Acp1'
ID402571
Institutional Source Beutler Lab
Gene Symbol Acp1
Ensembl Gene ENSMUSG00000044573
Gene Nameacid phosphatase 1, soluble
SynonymsLMW-PTP, 4632432E04Rik, Acp-1
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30893326-30911589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30905079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 36 (V36D)
Ref Sequence ENSEMBL: ENSMUSP00000151833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062740] [ENSMUST00000074038] [ENSMUST00000219697]
Predicted Effect probably benign
Transcript: ENSMUST00000062740
AA Change: V36D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106509
Gene: ENSMUSG00000044573
AA Change: V36D

DomainStartEndE-ValueType
LMWPc 7 156 1.58e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074038
AA Change: V36D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073686
Gene: ENSMUSG00000044573
AA Change: V36D

DomainStartEndE-ValueType
LMWPc 7 156 5.62e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218696
Predicted Effect probably benign
Transcript: ENSMUST00000219697
AA Change: V36D

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222791
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele show an increased mean serum IL-6 response to LPS challenge. Male homozygotes are smaller than controls whereas female homozygotes show an increased mean skin fibroblast proliferation rate. Males homozygous for a different null allele show decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Acp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Acp1 APN 12 30897793 missense probably damaging 1.00
IGL00929:Acp1 APN 12 30904900 missense probably damaging 1.00
IGL01982:Acp1 APN 12 30911492 missense possibly damaging 0.77
IGL03012:Acp1 APN 12 30895949 missense probably benign 0.08
R0918:Acp1 UTSW 12 30905127 nonsense probably null
R1433:Acp1 UTSW 12 30895935 missense possibly damaging 0.75
R1797:Acp1 UTSW 12 30896114 critical splice donor site probably null
R1854:Acp1 UTSW 12 30897805 missense possibly damaging 0.68
R4843:Acp1 UTSW 12 30896145 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCAAGCTCCAGTACGGTAC -3'
(R):5'- GGCATCCACTTTGGGAGTAG -3'

Sequencing Primer
(F):5'- TACCTGCCGTGCAATGTG -3'
(R):5'- ATCCACTTTGGGAGTAGTCCAC -3'
Posted On2016-07-22