Incidental Mutation 'R5225:Akap6'
ID402572
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52886546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 274 (V274I)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: V274I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: V274I

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: V274I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTGACTCCCTCACAGAAGTGG -3'
(R):5'- CCTAAGGAAGACGTCTCCAGTG -3'

Sequencing Primer
(F):5'- GACGACTCTGGGCAGTTAACTATC -3'
(R):5'- AAGACGTCTCCAGTGTTGAGC -3'
Posted On2016-07-22