Incidental Mutation 'R5225:Prdm15'
ID402586
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene NamePR domain containing 15
SynonymsZfp298, E130018M06Rik
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97791467-97851850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97808675 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 590 (H590N)
Ref Sequence ENSEMBL: ENSMUSP00000113791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
Predicted Effect probably damaging
Transcript: ENSMUST00000095849
AA Change: H616N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: H616N

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121584
AA Change: H590N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: H590N

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142295
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97806167 splice site probably benign
IGL01325:Prdm15 APN 16 97806517 missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97835829 missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97837605 unclassified probably null
IGL02502:Prdm15 APN 16 97839339 missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97821942 missense probably benign
R0408:Prdm15 UTSW 16 97835786 missense possibly damaging 0.92
R0437:Prdm15 UTSW 16 97812559 missense probably benign 0.00
R0497:Prdm15 UTSW 16 97794334 missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97797761 missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97837707 missense probably null 1.00
R0661:Prdm15 UTSW 16 97829682 missense probably benign 0.34
R0718:Prdm15 UTSW 16 97812633 missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97808708 missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97837600 missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97839306 missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97837685 missense probably benign 0.27
R2081:Prdm15 UTSW 16 97803780 nonsense probably null
R2208:Prdm15 UTSW 16 97799264 intron probably null
R3787:Prdm15 UTSW 16 97797745 missense probably benign 0.00
R3890:Prdm15 UTSW 16 97799571 missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97806515 missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97821786 missense probably benign 0.04
R4952:Prdm15 UTSW 16 97806077 missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97794489 missense probably damaging 0.97
R5505:Prdm15 UTSW 16 97816983 missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97799623 missense probably damaging 0.98
R5721:Prdm15 UTSW 16 97807096 missense possibly damaging 0.74
R5873:Prdm15 UTSW 16 97808689 missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97812570 nonsense probably null
R6311:Prdm15 UTSW 16 97799055 missense probably null 0.08
R6540:Prdm15 UTSW 16 97835805 missense probably benign 0.13
R7053:Prdm15 UTSW 16 97794542 nonsense probably null
R7241:Prdm15 UTSW 16 97795741 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGACACCCAGAAGTAGGATAACAG -3'
(R):5'- AAGTAGCTTGTCCTGTGGGC -3'

Sequencing Primer
(F):5'- CCCAGAAGTAGGATAACAGCCTTTAG -3'
(R):5'- GGCCATAGGGATCAGCTTATG -3'
Posted On2016-07-22