Incidental Mutation 'R5225:Snx2'
ID402593
Institutional Source Beutler Lab
Gene Symbol Snx2
Ensembl Gene ENSMUSG00000034484
Gene Namesorting nexin 2
Synonyms0610030A03Rik
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location53176365-53220860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53189712 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 56 (S56P)
Ref Sequence ENSEMBL: ENSMUSP00000039243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037850
AA Change: S56P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484
AA Change: S56P

DomainStartEndE-ValueType
Pfam:Sorting_nexin 2 134 1.6e-29 PFAM
PX 138 265 1.4e-38 SMART
Pfam:Vps5 281 514 2.2e-90 PFAM
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Pygm C A 19: 6,389,464 D279E probably benign Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Snx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Snx2 APN 18 53216400 missense possibly damaging 0.95
IGL00861:Snx2 APN 18 53210797 splice site probably null
IGL01116:Snx2 APN 18 53194423 splice site probably benign
IGL01642:Snx2 APN 18 53216447 missense probably damaging 0.99
IGL02178:Snx2 APN 18 53199785 missense possibly damaging 0.61
IGL02368:Snx2 APN 18 53189721 missense probably benign
IGL02597:Snx2 APN 18 53210372 missense probably benign 0.09
IGL02964:Snx2 APN 18 53194558 missense probably benign 0.00
IGL03372:Snx2 APN 18 53216391 missense probably damaging 1.00
blanched UTSW 18 53194444 missense probably damaging 0.98
bleached UTSW 18 53197925 splice site probably null
R0332:Snx2 UTSW 18 53212911 missense probably benign 0.01
R0723:Snx2 UTSW 18 53210372 missense probably benign 0.09
R0746:Snx2 UTSW 18 53197889 missense possibly damaging 0.90
R0826:Snx2 UTSW 18 53194522 missense probably benign 0.00
R0894:Snx2 UTSW 18 53176416 missense probably benign
R0970:Snx2 UTSW 18 53210690 splice site probably benign
R1897:Snx2 UTSW 18 53197878 missense probably damaging 0.99
R2049:Snx2 UTSW 18 53194444 missense probably damaging 0.98
R2910:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R2911:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R4460:Snx2 UTSW 18 53176444 missense probably benign 0.31
R5352:Snx2 UTSW 18 53197925 splice site probably null
R5450:Snx2 UTSW 18 53210712 missense probably damaging 0.99
R5576:Snx2 UTSW 18 53210750 missense probably benign 0.33
R5965:Snx2 UTSW 18 53194462 nonsense probably null
R6063:Snx2 UTSW 18 53209625 nonsense probably null
R6222:Snx2 UTSW 18 53199824 nonsense probably null
R6291:Snx2 UTSW 18 53209665 critical splice donor site probably null
R6890:Snx2 UTSW 18 53212879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACCTTGCTCTGAGTTTGG -3'
(R):5'- TTCACTCTCCAAGGTGTTACAG -3'

Sequencing Primer
(F):5'- GCCTCTAAAAGGGATGATATACTTG -3'
(R):5'- CACTCTCCAAGGTGTTACAGATAGAG -3'
Posted On2016-07-22