Incidental Mutation 'R5226:Plcg2'
ID402617
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117577874 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 273 (I273F)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081232
AA Change: I273F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I273F

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TATGTGGCTCTGAATGACATAGG -3'
(R):5'- TGGCGAAACAGGTAATCCCAC -3'

Sequencing Primer
(F):5'- GCTCTGAATGACATAGGTTTGAC -3'
(R):5'- GGTAATCCCACCCAGGTAAGAATCAG -3'
Posted On2016-07-22