Incidental Mutation 'R5227:Swt1'
ID402654
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene NameSWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151367699-151428455 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 151402976 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 227 (Q227*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
Predicted Effect probably null
Transcript: ENSMUST00000064771
AA Change: Q477*
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: Q477*

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111883
AA Change: Q477*
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: Q477*

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129939
AA Change: Q227*
SMART Domains Protein: ENSMUSP00000120483
Gene: ENSMUSG00000052748
AA Change: Q227*

DomainStartEndE-ValueType
PINc 146 245 6.78e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000141977
AA Change: T17I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189595
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151411139 missense probably damaging 0.99
IGL01622:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01623:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01672:Swt1 APN 1 151394608 critical splice donor site probably null
IGL01693:Swt1 APN 1 151422104 missense probably benign 0.02
IGL02203:Swt1 APN 1 151370626 missense probably benign 0.01
IGL03223:Swt1 APN 1 151379419 missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151391529 missense probably damaging 1.00
R0496:Swt1 UTSW 1 151411270 missense probably benign
R1037:Swt1 UTSW 1 151370569 splice site probably benign
R1171:Swt1 UTSW 1 151405521 missense probably damaging 1.00
R1270:Swt1 UTSW 1 151384391 missense probably benign 0.00
R1883:Swt1 UTSW 1 151423533 nonsense probably null
R2051:Swt1 UTSW 1 151372330 missense probably damaging 1.00
R2110:Swt1 UTSW 1 151403885 missense probably damaging 0.97
R2185:Swt1 UTSW 1 151384468 missense probably damaging 1.00
R3688:Swt1 UTSW 1 151391489 missense probably damaging 0.99
R3785:Swt1 UTSW 1 151379404 missense probably benign 0.03
R4074:Swt1 UTSW 1 151394769 missense probably benign
R4157:Swt1 UTSW 1 151403044 missense probably damaging 1.00
R4660:Swt1 UTSW 1 151407597 missense probably benign 0.18
R4761:Swt1 UTSW 1 151401102 missense probably benign 0.43
R4972:Swt1 UTSW 1 151423542 missense probably benign 0.22
R5141:Swt1 UTSW 1 151411394 missense probably benign 0.04
R5400:Swt1 UTSW 1 151412834 missense probably benign 0.00
R5580:Swt1 UTSW 1 151384455 missense probably benign 0.00
R5912:Swt1 UTSW 1 151411409 missense probably damaging 1.00
R5945:Swt1 UTSW 1 151411170 missense probably benign 0.01
R5973:Swt1 UTSW 1 151402949 splice site probably null
R5979:Swt1 UTSW 1 151407588 missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151407614 missense probably benign 0.41
R6283:Swt1 UTSW 1 151384333 missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151397268 missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151370630 missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151388677 missense probably damaging 1.00
R7214:Swt1 UTSW 1 151394613 missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151388693 missense probably benign 0.01
R7439:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7441:Swt1 UTSW 1 151411064 missense probably benign 0.04
X0062:Swt1 UTSW 1 151411439 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCAAGGATTCCCAAAATGAGCC -3'
(R):5'- TGGAGACGACACTTAAAACTGTG -3'

Sequencing Primer
(F):5'- GATTCCCAAAATGAGCCATAAATTAC -3'
(R):5'- GGTTTAGTACCTCAATACATGCTGG -3'
Posted On2016-07-22