Incidental Mutation 'R5227:Olfml3'
ID402660
Institutional Source Beutler Lab
Gene Symbol Olfml3
Ensembl Gene ENSMUSG00000027848
Gene Nameolfactomedin-like 3
Synonyms2810002E22Rik, HNOEL-iso, mONT3, ONT3
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103722222-103738001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103736421 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 215 (Y215H)
Ref Sequence ENSEMBL: ENSMUSP00000029440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029440] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000169286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029440
AA Change: Y215H

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029440
Gene: ENSMUSG00000027848
AA Change: Y215H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Blast:OLF 65 133 8e-34 BLAST
OLF 137 401 9.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably benign
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157042
Predicted Effect probably benign
Transcript: ENSMUST00000169286
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the olfactomedin-like gene family which also includes genes encoding noelin, tiarin, myocilin, amassin, optimedin, photomedin, and latrophilin. The encoded protein is a secreted extracellular matrix glycoprotein with a C-terminal olfactomedin domain that facilitates protein-protein interactions, cell adhesion, and intercellular interactions. It serves as both a scaffold protein that recruits bone morphogenetic protein 1 to its substrate chordin, and as a vascular tissue remodeler with pro-angiogenic properties. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Olfml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Olfml3 APN 3 103736982 unclassified probably null
IGL02130:Olfml3 APN 3 103736967 missense probably benign 0.20
R0133:Olfml3 UTSW 3 103737026 unclassified probably null
R0427:Olfml3 UTSW 3 103737014 missense probably benign 0.27
R2130:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2131:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2133:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R4688:Olfml3 UTSW 3 103732181 utr 3 prime probably benign
R5211:Olfml3 UTSW 3 103737199 missense probably benign
R6223:Olfml3 UTSW 3 103736460 missense probably damaging 1.00
R6493:Olfml3 UTSW 3 103736207 missense possibly damaging 0.61
R7128:Olfml3 UTSW 3 103737168 missense probably benign
R7191:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7224:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7298:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7299:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7300:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7355:Olfml3 UTSW 3 103736079 missense probably damaging 1.00
X0058:Olfml3 UTSW 3 103732116 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TCTCGAGTGGCATAGACAGC -3'
(R):5'- TATGGACCAAGGATCCGCTG -3'

Sequencing Primer
(F):5'- CATCAGCTGCCAGGTCGATATATG -3'
(R):5'- CTGGGGCCAGCAGAGAAGATC -3'
Posted On2016-07-22