Incidental Mutation 'R5227:Fbxl4'
ID402664
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22376840 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 92 (T92M)
Ref Sequence ENSEMBL: ENSMUSP00000138825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably damaging
Transcript: ENSMUST00000039234
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: T92M

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131972
Predicted Effect probably damaging
Transcript: ENSMUST00000184455
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000184582
AA Change: T92M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: T92M

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185029
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: T92M

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 intron probably null
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
R7164:Fbxl4 UTSW 4 22386218 missense probably benign 0.00
R7264:Fbxl4 UTSW 4 22386145 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGACTATAGTGTCAAACAGCCG -3'
(R):5'- ACTTCAGCTGGAGGATTTGG -3'

Sequencing Primer
(F):5'- TATAGTGTCAAACAGCCGGACTTC -3'
(R):5'- CAGAATTCTGATGACTGCTCCAGG -3'
Posted On2016-07-22