Incidental Mutation 'R5227:Vmn1r49'
ID402672
Institutional Source Beutler Lab
Gene Symbol Vmn1r49
Ensembl Gene ENSMUSG00000095932
Gene Namevomeronasal 1, receptor 49
SynonymsVRi2, V1rb2, V1r5
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90071893-90078506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90072771 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 83 (T83I)
Ref Sequence ENSEMBL: ENSMUSP00000154456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071865] [ENSMUST00000203791] [ENSMUST00000226368]
Predicted Effect probably benign
Transcript: ENSMUST00000071865
AA Change: T83I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071762
Gene: ENSMUSG00000095932
AA Change: T83I

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203791
AA Change: T83I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145107
Gene: ENSMUSG00000095932
AA Change: T83I

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226368
AA Change: T83I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a non-functional knock-in allele display abnormal patterns of axonal projections in the accessory olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Vmn1r49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Vmn1r49 APN 6 90072412 missense probably damaging 0.99
IGL03230:Vmn1r49 APN 6 90072668 missense probably damaging 1.00
IGL03308:Vmn1r49 APN 6 90072359 missense possibly damaging 0.67
R0517:Vmn1r49 UTSW 6 90072738 missense probably damaging 0.98
R0638:Vmn1r49 UTSW 6 90072666 missense possibly damaging 0.95
R1498:Vmn1r49 UTSW 6 90072316 missense probably damaging 1.00
R1649:Vmn1r49 UTSW 6 90072641 missense possibly damaging 0.66
R1668:Vmn1r49 UTSW 6 90072782 missense probably benign 0.07
R1816:Vmn1r49 UTSW 6 90072803 missense possibly damaging 0.93
R2071:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R2155:Vmn1r49 UTSW 6 90072459 missense probably damaging 0.99
R2274:Vmn1r49 UTSW 6 90072144 missense probably benign 0.23
R4222:Vmn1r49 UTSW 6 90072246 missense probably benign 0.06
R4614:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
R4797:Vmn1r49 UTSW 6 90072630 missense probably benign 0.13
R4978:Vmn1r49 UTSW 6 90072890 missense probably benign 0.30
R5959:Vmn1r49 UTSW 6 90072804 missense probably damaging 1.00
R6741:Vmn1r49 UTSW 6 90072213 missense probably benign 0.19
R6744:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R7173:Vmn1r49 UTSW 6 90072268 missense possibly damaging 0.96
R7457:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCTTCTGAGGTCAAGTTGGG -3'
(R):5'- TGTTGGGATCTCAGCTAACAC -3'

Sequencing Primer
(F):5'- TCAAGTTGGGGGTAACAATAATTG -3'
(R):5'- GTTGGGATCTCAGCTAACACTATCC -3'
Posted On2016-07-22