Incidental Mutation 'R5227:Fkrp'
ID402675
Institutional Source Beutler Lab
Gene Symbol Fkrp
Ensembl Gene ENSMUSG00000048920
Gene Namefukutin related protein
SynonymsA830029B19Rik, MDC1C, LGMD1I
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16809246-16816732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16810710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 409 (E409G)
Ref Sequence ENSEMBL: ENSMUSP00000059091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061390] [ENSMUST00000206259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061390
AA Change: E409G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059091
Gene: ENSMUSG00000048920
AA Change: E409G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Pfam:LicD 334 374 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205677
Predicted Effect probably benign
Transcript: ENSMUST00000206259
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is targeted to the medial Golgi apparatus and is necessary for posttranslational modification of dystroglycan. Mutations in this gene have been associated with congenital muscular dystrophy, mental retardation, and cerebellar cysts. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die by E10.5. Mice homozygous for a knock-in allele exhibit a progressive muscular dystrophy phenotype, abnormal brain morphology, defecting neuron migration, reduced body weight, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Fkrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Fkrp APN 7 16811490 missense probably benign 0.02
R1177:Fkrp UTSW 7 16810527 missense probably damaging 1.00
R1722:Fkrp UTSW 7 16810794 missense probably benign 0.20
R1984:Fkrp UTSW 7 16811877 missense probably benign 0.11
R2519:Fkrp UTSW 7 16810952 nonsense probably null
R5566:Fkrp UTSW 7 16810924 missense probably damaging 1.00
R6513:Fkrp UTSW 7 16811112 missense possibly damaging 0.90
R6939:Fkrp UTSW 7 16811826 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTCCGGGTTCTCGATGAC -3'
(R):5'- TTTGGCTGCAGCAAGGAGAG -3'

Sequencing Primer
(F):5'- AACTTCAGCTCCAGGAAGCGG -3'
(R):5'- ACCCGCCTACCTGTATGAG -3'
Posted On2016-07-22