Incidental Mutation 'R5227:Ccpg1'
ID402685
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Namecell cycle progression 1
Synonyms1700030B06Rik, D9Ertd392e, 1810073J13Rik, 9430028F23Rik
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72985429-73016340 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 73012072 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 323 (L323*)
Ref Sequence ENSEMBL: ENSMUSP00000122966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000093819] [ENSMUST00000098566] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably null
Transcript: ENSMUST00000037977
AA Change: L323*
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: L323*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085350
AA Change: L323*
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: L323*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093819
Predicted Effect probably benign
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124008
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138466
Predicted Effect probably null
Transcript: ENSMUST00000140675
AA Change: L323*
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: L323*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000150826
AA Change: L323*
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: L323*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 73005877 missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72997441 utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72997453 missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 73001877 critical splice donor site probably null
R0586:Ccpg1 UTSW 9 73001821 missense probably benign 0.00
R1188:Ccpg1 UTSW 9 73012506 missense possibly damaging 0.55
R1503:Ccpg1 UTSW 9 72999478 missense probably benign 0.00
R1599:Ccpg1 UTSW 9 72999125 nonsense probably null
R2130:Ccpg1 UTSW 9 73013158 missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 73013106 missense probably benign 0.00
R3052:Ccpg1 UTSW 9 73005868 missense probably damaging 1.00
R4155:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4156:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4157:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4257:Ccpg1 UTSW 9 73012627 missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 73015915 intron probably benign
R5081:Ccpg1 UTSW 9 72999078 missense possibly damaging 0.94
R5288:Ccpg1 UTSW 9 73013044 missense probably benign
R5385:Ccpg1 UTSW 9 73013044 missense probably benign
R5386:Ccpg1 UTSW 9 73013044 missense probably benign
R5412:Ccpg1 UTSW 9 73010306 missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 73013244 missense possibly damaging 0.78
R6230:Ccpg1 UTSW 9 73012356 missense probably benign 0.00
R7269:Ccpg1 UTSW 9 73013327 missense probably benign 0.06
R7287:Ccpg1 UTSW 9 73015406 missense probably benign 0.05
R7542:Ccpg1 UTSW 9 73012459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCATGGTGGTTACATG -3'
(R):5'- ATCCTTGCCTCCTCCAAGAG -3'

Sequencing Primer
(F):5'- GGCATGGTGGTTACATGATTAAAG -3'
(R):5'- AAGAGCATCTCCCTTTCCCTAAG -3'
Posted On2016-07-22