Incidental Mutation 'R5227:Heg1'
ID402704
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
MMRRC Submission 042800-MU
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33763591 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1256 (L1256Q)
Ref Sequence ENSEMBL: ENSMUSP00000155944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000128105] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect probably damaging
Transcript: ENSMUST00000126532
AA Change: L1280Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: L1280Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000128105
AA Change: L81Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146518
Predicted Effect probably damaging
Transcript: ENSMUST00000152782
AA Change: L1025Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254
AA Change: L1025Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152832
Predicted Effect probably damaging
Transcript: ENSMUST00000232568
AA Change: L1256Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACACTCAGTCTTGTCGAAGATG -3'
(R):5'- TCACACTGAAGAACTCCATGTC -3'

Sequencing Primer
(F):5'- CACTCAGTCTTGTCGAAGATGTCATG -3'
(R):5'- TGAAGAACTCCATGTCACCAGG -3'
Posted On2016-07-22