Incidental Mutation 'R5228:Ibtk'
ID402740
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5228 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85726689 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 390 (E390G)
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039213
AA Change: E390G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: E390G

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186447
Predicted Effect probably benign
Transcript: ENSMUST00000187521
AA Change: E390G

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941
AA Change: E390G

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Ahnak2 A G 12: 112,775,386 S751P probably benign Het
Aifm2 T C 10: 61,732,417 V201A probably damaging Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gli2 T A 1: 118,836,206 D1405V probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Ipo7 T A 7: 110,046,762 C504S probably benign Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179 splice site probably benign
IGL02223:Ibtk APN 9 85710366 splice site probably benign
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0932:Ibtk UTSW 9 85735046 missense probably damaging 1.00
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1245:Ibtk UTSW 9 85720742 critical splice donor site probably null
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R2446:Ibtk UTSW 9 85703073 missense probably benign 0.22
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R4947:Ibtk UTSW 9 85710412 missense probably benign 0.00
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85720863 missense probably benign 0.13
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTGTGTCTCTGCAACCCTAG -3'
(R):5'- CATGTGTGAGTTGAGGCCATAG -3'

Sequencing Primer
(F):5'- CTCCACTAGATGTCATAGAAGGGTC -3'
(R):5'- TGTGTGAGTTGAGGCCATAGGAAAG -3'
Posted On2016-07-22