Incidental Mutation 'R5228:Aifm2'
ID402743
Institutional Source Beutler Lab
Gene Symbol Aifm2
Ensembl Gene ENSMUSG00000020085
Gene Nameapoptosis-inducing factor, mitochondrion-associated 2
Synonyms5430437E11Rik, D730001I10Rik, Amid, PRG3
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5228 (G1)
Quality Score171
Status Not validated
Chromosome10
Chromosomal Location61715263-61739260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61732417 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000101095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067857] [ENSMUST00000080099] [ENSMUST00000099706] [ENSMUST00000105455]
Predicted Effect probably damaging
Transcript: ENSMUST00000067857
AA Change: V201A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070054
Gene: ENSMUSG00000020085
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080099
AA Change: V201A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078998
Gene: ENSMUSG00000020085
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 12 302 5.4e-43 PFAM
Pfam:K_oxygenase 94 190 5.2e-7 PFAM
Pfam:Pyr_redox 144 230 7.2e-10 PFAM
low complexity region 328 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099706
AA Change: V201A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097297
Gene: ENSMUSG00000020085
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105455
AA Change: V201A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101095
Gene: ENSMUSG00000020085
AA Change: V201A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140664
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavoprotein oxidoreductase that binds single stranded DNA and is thought to contribute to apoptosis in the presence of bacterial and viral DNA. The expression of this gene is also found to be induced by tumor suppressor protein p53 in colon cancer cells. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display reduced sensitivity to genotoxin induced cellular growth inhibition but have no change in spontaneous or induced tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Ahnak2 A G 12: 112,775,386 S751P probably benign Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gli2 T A 1: 118,836,206 D1405V probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Ipo7 T A 7: 110,046,762 C504S probably benign Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in Aifm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Aifm2 APN 10 61735548 missense possibly damaging 0.62
IGL02561:Aifm2 APN 10 61726007 missense probably damaging 1.00
IGL02708:Aifm2 APN 10 61738575 utr 3 prime probably benign
R0690:Aifm2 UTSW 10 61726452 missense probably benign 0.01
R2119:Aifm2 UTSW 10 61735604 missense possibly damaging 0.60
R2404:Aifm2 UTSW 10 61728195 missense probably benign 0.08
R4698:Aifm2 UTSW 10 61727756 missense probably benign 0.00
R4826:Aifm2 UTSW 10 61725989 missense probably benign
R5668:Aifm2 UTSW 10 61725917 missense probably damaging 1.00
R7378:Aifm2 UTSW 10 61727717 missense possibly damaging 0.79
X0025:Aifm2 UTSW 10 61735485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTATTAGATGGGAAGTCGG -3'
(R):5'- GTCCTGTTCCTAAGCTACAGC -3'

Sequencing Primer
(F):5'- GAGAGAGGACTCGGAGGCTTC -3'
(R):5'- TGGACACAGCTCAAGCCAG -3'
Posted On2016-07-22