Incidental Mutation 'R5228:Ahnak2'
ID402747
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 042801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5228 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112775386 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 751 (S751P)
Ref Sequence ENSEMBL: ENSMUSP00000122404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
AA Change: S751P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812
AA Change: S751P

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,288,659 probably null Het
Agrn G T 4: 156,166,946 A1864D probably damaging Het
Aifm2 T C 10: 61,732,417 V201A probably damaging Het
C1rl C T 6: 124,508,468 A266V probably damaging Het
Clec2h G T 6: 128,674,786 A153S probably benign Het
Dnah7a T C 1: 53,437,609 probably null Het
Frmpd1 T C 4: 45,284,322 S1048P probably damaging Het
Galnt16 A T 12: 80,584,048 D300V probably damaging Het
Gbp8 G T 5: 105,016,185 Q416K probably benign Het
Gldn C T 9: 54,334,719 T319I probably damaging Het
Gli2 T A 1: 118,836,206 D1405V probably damaging Het
Gtsf2 A G 15: 103,444,615 Y45H probably damaging Het
Hmcn1 C A 1: 150,646,701 V3483F probably benign Het
Hspa12b T C 2: 131,142,964 V385A possibly damaging Het
Ibtk T C 9: 85,726,689 E390G possibly damaging Het
Inpp4b C G 8: 81,768,115 P53R probably damaging Het
Ipo7 T A 7: 110,046,762 C504S probably benign Het
Iws1 A G 18: 32,088,261 D549G probably damaging Het
Kcnh4 T C 11: 100,746,896 D645G probably damaging Het
Klhl40 A G 9: 121,777,801 E9G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Morc2a T C 11: 3,685,439 V810A probably damaging Het
Myo1e C A 9: 70,322,358 probably null Het
N4bp2 T C 5: 65,807,518 V970A probably benign Het
Pira2 T A 7: 3,844,374 K105N probably benign Het
Pml G A 9: 58,219,997 R61C probably damaging Het
Pms2 T C 5: 143,923,597 L76P probably damaging Het
Rlbp1 T G 7: 79,377,334 T193P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGG 11: 3,153,384 probably benign Homo
Sh3rf2 T C 18: 42,153,181 S548P possibly damaging Het
Slc4a4 A G 5: 89,156,525 D609G possibly damaging Het
Slk A T 19: 47,625,332 I876F probably damaging Het
Tcf20 G A 15: 82,855,955 P432S probably benign Het
Tenm3 A C 8: 48,236,355 S2066A probably damaging Het
Topors G C 4: 40,262,367 L306V probably damaging Het
Trappc9 A T 15: 73,057,995 S171T probably damaging Het
Ube2m G T 7: 13,035,770 probably benign Het
Vmn1r37 T C 6: 66,732,298 *266Q probably null Het
Vmn2r34 T C 7: 7,672,341 T683A probably damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
Predicted Primers PCR Primer
(F):5'- TTGAGGACAAACTTAGACTGGG -3'
(R):5'- TCAAGGTAGTACACTCCCTCC -3'

Sequencing Primer
(F):5'- CAAACTTAGACTGGGTGTGGG -3'
(R):5'- GTATTGTTCCCCAAATTTCACAGAC -3'
Posted On2016-07-22